After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь CHAC2 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse CHAC2 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_175175.4
Размер кДНК:537 bp
Описание кДНК:Full length Clone DNA of Mus musculus ChaC, cation transport regulator 2
Синоним гена:Chac2
Виды:Mouse
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at ambient temperature for three months.
Мышь CHAC2 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Мышь CHAC2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG52452-ACGRBS15400
Мышь CHAC2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG52452-ACRRBS15400
Мышь CHAC2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG52452-ANGRBS15400
Мышь CHAC2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG52452-ANRRBS15400
Мышь CHAC2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG52452-CFRBS5130
Мышь CHAC2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG52452-CHRBS13340
Мышь CHAC2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG52452-CMRBS13340
Мышь CHAC2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG52452-CYRBS13340
Mouse CHAC2 Gene cDNA clone plasmidMG52452-GRBS5130
Мышь CHAC2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG52452-NFRBS13340
Мышь CHAC2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG52452-NHRBS13340
Мышь CHAC2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG52452-NMRBS13340
Мышь CHAC2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG52452-NYRBS13340
Мышь CHAC2 Джин клон кДНК в вектор клонированияMG52452-URBS5130
Мышь CHAC2 Джин ORF экспрессии кДНК клона плазмидыMG52452-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG52452-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».