Cofilin cDNA ORF Clone, Mouse, N-Myc tag

1/1
Price:
Size:
Number:

Cofilin cDNA ORF Clone, Mouse, N-Myc tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
546 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse cofilin 1, non-muscle with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Restriction Sites
KpnI + XbaI(6kb+0.55kb)
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Cofilin cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Cofilin cDNA ORF Clone, Mouse, N-Myc tag: Validated Images

Cofilin cDNA ORF Clone, Mouse, N-Myc tag: Alternative Names

AA959946 cDNA ORF Clone, Mouse; Cof cDNA ORF Clone, Mouse; n-cofilin cDNA ORF Clone, Mouse

Cofilin Background Information

CFL1, also known as n-cofilin, is a member of the ADF/Cofilin family. This family comprises three genes: CFL1, CFL2 and DSTN (destrin). ADF/Cofilin family members bind G-actin monomers and depolymerize actin filaments through two mechanisms: severing and increasing the off-rate for actin monomers from the pointed end. Cofilin also binds with other proteins such as myosin, tropomyosin, α-actinin, gelsolin and scruin. These proteins compete with cofilin for actin binding. Сofilin also plays a role in innate immune response. CFL1 contains 1 ADF-H domain and is widely distributed in various tissues. It is important for normal progress through mitosis and normal cytokinesis.
Full Name
cofilin 1 (non-muscle)
References
  • Lappalainen P. et al., 1997, Nature. 388 (6637): 78-82.
  • Ichetovkin I. et al., 2000, Cell Motil. 45 (4): 293-306.
  • Carlier MF. et al., 1997, J Cell Biol. 136 (6): 1307-22.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait