Быстрый заказ

Мышь CFL1 / cofilin Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse CFL1 Информация о продукте «Клон cDNA»
Размер кДНК:501bp
Описание кДНК:Full length Clone DNA of Mus musculus cofilin 1, non-muscle with N terminal Myc tag.
Синоним гена:Cof, AA959946, n-cofilin
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Мышь CFL1 / cofilin Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Мышь CFL1 / cofilin Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51445-ACGRBS15400
Мышь CFL1 / cofilin Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51445-ACRRBS15400
Мышь CFL1 / cofilin Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51445-ANGRBS15400
Мышь CFL1 / cofilin Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51445-ANRRBS15400
Мышь CFL1 / cofilin Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51445-CFRBS13340
Мышь CFL1 / cofilin Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51445-CHRBS13340
Мышь CFL1 / cofilin Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51445-CMRBS13340
Мышь CFL1 / cofilin Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51445-CYRBS13340
Мышь CFL1 / cofilin Джин клон кДНК в вектор клонированияMG51445-GRBS5130
Мышь CFL1 / cofilin Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51445-NFRBS13340
Мышь CFL1 / cofilin Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51445-NHRBS13340
Мышь CFL1 / cofilin Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51445-NMRBS13340
Мышь CFL1 / cofilin Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51445-NYRBS13340
Мышь CFL1 / cofilin Джин ORF экспрессии кДНК клона плазмидыMG51445-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

CFL1, also known as n-cofilin, is a member of the ADF/Cofilin family. This family comprises three genes: CFL1, CFL2 and DSTN (destrin). ADF/Cofilin family members bind G-actin monomers and depolymerize actin filaments through two mechanisms: severing and increasing the off-rate for actin monomers from the pointed end. Cofilin also binds with other proteins such as myosin, tropomyosin, α-actinin, gelsolin and scruin. These proteins compete with cofilin for actin binding. Сofilin also plays a role in innate immune response. CFL1 contains 1 ADF-H domain and is widely distributed in various tissues. It is important for normal progress through mitosis and normal cytokinesis.

  • Lappalainen P. et al., 1997, Nature. 388 (6637): 78-82.
  • Ichetovkin I. et al., 2000, Cell Motil. 45 (4): 293-306.
  • Carlier MF. et al., 1997, J Cell Biol. 136 (6): 1307-22.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.