After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь FACTOR D/Adipsin Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse CFD Информация о продукте «Клон cDNA»
Размер кДНК:777bp
Описание кДНК:Full length Clone DNA of Mus musculus complement factor D (adipsin) with N terminal HA tag.
Синоним гена:DF, Adn, Cfd
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Мышь FACTOR D/Adipsin Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
Мышь FACTOR D/Adipsin Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50539-ACGRBS15400
Мышь FACTOR D/Adipsin Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50539-ACRRBS15400
Мышь FACTOR D/Adipsin Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50539-CFRBS13340
Мышь FACTOR D/Adipsin Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50539-CHRBS13340
Мышь FACTOR D/Adipsin Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50539-CMRBS13340
Мышь FACTOR D/Adipsin Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50539-CYRBS13340
Мышь FACTOR D/Adipsin Джин клон кДНК в вектор клонированияMG50539-MRBS5130
Мышь FACTOR D/Adipsin Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50539-NFRBS13340
Мышь FACTOR D/Adipsin Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50539-NHRBS13340
Мышь FACTOR D/Adipsin Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50539-NMRBS13340
Мышь FACTOR D/Adipsin Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50539-NYRBS13340
Мышь FACTOR D/Adipsin Джин ORF экспрессии кДНК клона плазмидыMG50539-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Mouse complement factor D, also known as Adipsin, C3 convertase activator, Properdin factor D and CFD is a secreted protein which belongs to the peptidase S1 family. CFD / Adipsin contains one peptidase S1 domain. Complement factor D ( CFD / Adipsin ) is a component of the alternative complement pathway best known for its role in humoral suppression of infectious agents. Complement factor D ( CFD / Adipsin ) has a high level of expression in fat, suggesting a role for adipose tissue in immune system biology. This protein is also a serine protease that is secreted by adipocytes into the bloodstream. Complement factor D ( CFD / Adipsin ) cleaves factor B when the latter is complexed with factor C3b, activating the C3bbb complex, which then becomes the C3 convertase of the alternate pathway. Its function is homologous to that of C1s in the classical pathway. Complement factor D ( CFD / Adipsin ) is a serine protease that stimulates glucose transport for triglyceride accumulation in fats cells and inhibits lipolysis. Defects in CFD / Adipsin are the cause of complement factor D deficiency (CFD deficiency) which predisposes to invasive meningococcal disease.

  • Volanakis JE, et al.,1996, Protein Sci. 5 (4): 553-64.
  • Searfoss,G.H et al., 2003, J Biol Chem. 278 (46):46107-16.
  • Ukkola,O. et al., 2003, Eur J Clin Nutr. 57 (9):1073-8.
  • Ronti T, et al., 2006, Clin. Endocrinol. (Oxf) 64 (4): 355-65.
  • Size / Price
    Каталог: MG50539-NY
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.