After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь CES2/Carboxylesterase 2 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse CES2 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_145603.1
Размер кДНК:1686bp
Описание кДНК:Full length Clone DNA of Mus musculus carboxylesterase 2 with C terminal HA tag.
Синоним гена:ces2A3, Ces2
Виды:Mouse
переносчик:pCMV3-C-HA
Plasmid:
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Мышь CES2/Carboxylesterase 2 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Мышь CES2/Carboxylesterase 2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50515-ACGRBS16760
Мышь CES2/Carboxylesterase 2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50515-ACRRBS16760
Мышь CES2/Carboxylesterase 2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50515-CFRBS14710
Мышь CES2/Carboxylesterase 2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50515-CHRBS14710
Мышь CES2/Carboxylesterase 2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50515-CMRBS14710
Мышь CES2/Carboxylesterase 2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50515-CYRBS14710
Мышь CES2/Carboxylesterase 2 Джин клон кДНК в вектор клонированияMG50515-MRBS5130
Мышь CES2/Carboxylesterase 2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50515-NFRBS14710
Мышь CES2/Carboxylesterase 2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50515-NHRBS14710
Мышь CES2/Carboxylesterase 2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50515-NMRBS14710
Мышь CES2/Carboxylesterase 2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50515-NYRBS14710
Мышь CES2/Carboxylesterase 2 Джин ORF экспрессии кДНК клона плазмидыMG50515-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Carboxylesterase 2 (CES2) is a member of the carboxylesterase family and belongs to the multigene family. Carboxylesterase 2 is responsible for the hydrolysis of ester- and amide-bond-containing drugs such as cocaine and beroin. It also serves to hydrolyze long-chain fatty acid esters and thioesters. It is speculated that carboxylesterases may play a role in lipid metabolism and the blood-brain barrier system and together with isform 1, are a serine esterase involved in both drug metabolism and activation. Human carboxylesterase 2 is commonly expressed in tumor tissues and irinotecan, a topoisomerase I inhibitor commonly used in the treatment of many solid tumors.

Ссылки
  • Imai T. et al. (2006) Human carboxylesterase isozymes: catalytic properties and rational drug design. Drug metab pharmacokinet. 21 (3): 173-85.
  • Guang Xu, et al. (2002) Human carboxylesterase 2 is commonly expressed in tumor tissue and is correlated with activation of irinotecan. Clin Cancer Res. 8: 2605.
  • Zhang, et al. (2002) Comprehensive Evaluation of Carboxylesterase-2 Expression in Normal Human Tissues Using Tissue Array Analysis. Applied Immunohistochemistry & Molecular Morphology. 10 (4): 374-80.
  • Size / Price
    Каталог: MG50515-CY
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».