After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Мышь LASS2/ceramide synthase 2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse CERS2 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_029789.1
Размер кДНК:1143bp
Описание кДНК:Full length Clone DNA of Mus musculus ceramide synthase 2 with C terminal Myc tag.
Синоним гена:TRH3; Lass2; AI225939; 0610013I17Rik
Виды:Mouse
переносчик:pCMV3-C-Myc
Plasmid:
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Мышь LASS2/ceramide synthase 2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка on other vectors
Мышь LASS2/ceramide synthase 2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51624-ACGRBS15400
Мышь LASS2/ceramide synthase 2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51624-ACRRBS15400
Мышь LASS2/ceramide synthase 2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51624-ANGRBS15400
Мышь LASS2/ceramide synthase 2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51624-ANRRBS15400
Мышь LASS2/ceramide synthase 2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51624-CFRBS13340
Мышь LASS2/ceramide synthase 2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51624-CHRBS13340
Мышь LASS2/ceramide synthase 2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51624-CMRBS13340
Мышь LASS2/ceramide synthase 2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51624-CYRBS13340
Mouse CERS2 Gene cDNA clone plasmidMG51624-GRBS3620
Мышь LASS2/ceramide synthase 2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51624-NFRBS13340
Мышь LASS2/ceramide synthase 2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51624-NHRBS13340
Мышь LASS2/ceramide synthase 2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51624-NMRBS13340
Мышь LASS2/ceramide synthase 2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51624-NYRBS13340
Мышь LASS2/ceramide synthase 2 Джин клон кДНК в вектор клонированияMG51624-URBS5130
Мышь LASS2/ceramide synthase 2 Джин ORF экспрессии кДНК клона плазмидыMG51624-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG51624-CM
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».