Быстрый заказ

Мышь CDR2 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse CDR2 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_007672.2
Размер кДНК:1368bp
Описание кДНК:Full length Clone DNA of Mus musculus cerebellar degeneration-related 2 with C terminal HA tag.
Синоним гена:AA617262
Виды:Mouse
переносчик:pCMV3-C-HA
Plasmid:
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Мышь CDR2 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Мышь CDR2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51762-ACGRBS15400
Мышь CDR2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51762-ACRRBS15400
Мышь CDR2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51762-ANGRBS15400
Мышь CDR2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51762-ANRRBS15400
Мышь CDR2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51762-CFRBS13340
Мышь CDR2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51762-CHRBS13340
Мышь CDR2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51762-CMRBS13340
Мышь CDR2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51762-CYRBS13340
Мышь CDR2 Джин клон кДНК в вектор клонированияMG51762-GRBS5130
Мышь CDR2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51762-NFRBS13340
Мышь CDR2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51762-NHRBS13340
Мышь CDR2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51762-NMRBS13340
Мышь CDR2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51762-NYRBS13340
Мышь CDR2 Джин ORF экспрессии кДНК клона плазмидыMG51762-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG51762-CY
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».