Быстрый заказ

Text Size:AAA

Мышь CDK2 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse CDK2 Информация о продукте «Клон cDNA»
Размер кДНК:897bp
Описание кДНК:Full length Clone DNA of Mus musculus cyclin-dependent kinase 2, transcript variant 2 with N terminal Myc tag.
Синоним гена:A630093N05Rik, Cdk2
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Мышь CDK2 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Мышь CDK2 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50796-ACGRBS15400
Мышь CDK2 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50796-ACRRBS15400
Мышь CDK2 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG50796-ANGRBS15400
Мышь CDK2 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG50796-ANRRBS15400
Мышь CDK2 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50796-CFRBS13340
Мышь CDK2 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50796-CHRBS13340
Мышь CDK2 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50796-CMRBS13340
Мышь CDK2 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50796-CYRBS13340
Мышь CDK2 transcript variant 2 Джин клон кДНК в вектор клонированияMG50796-GRBS5130
Мышь CDK2 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50796-NFRBS13340
Мышь CDK2 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50796-NHRBS13340
Мышь CDK2 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50796-NMRBS13340
Мышь CDK2 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50796-NYRBS13340
Мышь CDK2 transcript variant 2 Джин ORF экспрессии кДНК клона плазмидыMG50796-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

CDK2 is a member of the Ser/Thr protein kinase family. This protein kinase is highly similar to the gene products of S. cerevisiae cdc28, and S. pombe cdc2. It is a catalytic subunit of the cyclin-dependent protein kinase complex, whose activity is restricted to the G1-S phase, and essential for cell cycle G1/S phase transition. Cdks (cyclin-dependent kinases) are heteromeric serine/threonine kinases that control progression through the cell cycle in concert with their regulatory subunits, the cyclins. Cdks are constitutively expressed and are regulated by several kinases and phosphastases, including Wee1, CDK-activating kinase and Cdc25 phosphatase. Although there are 12 different cdk genes, only 5 have been shown to directly drive the cell cycle (Cdk1, -2, -3, -4, and -6). Following extracellular mitogenic stimuli, cyclin D gene expression is upregulated. Cdk4 forms a complex with cyclin D and phosphorylates Rb protein, leading to liberation of the transcription factor E2F. E2F induces transcription of genes including cyclins A and E, DNA polymerase and thymidine kinase. Cdk4-cyclin E complexes form and initiate G1/S transition. Subsequently, Cdk1-cyclin B complexes form and induce G2/M phase transition. Cdk1-cyclin B activation induces the breakdown of the nuclear envelope and the initiation of mitosis. CDK2 associates with and regulated by the regulatory subunits of the complex including cyclin A or E, CDK inhibitor p21Cip1 (CDKN1A) and p27Kip1 (CDKN1B). Its activity is also regulated by its protein phosphorylation. CDK2 is involved in the control of the cell cycle. It also interacts with cyclins A, B1, B3, D, or E. Activity of CDK2 is maximal during S phase and G2.

  • Bao ZQ, et al. (2011) Briefly bound to activate: transient binding of a second catalytic magnesium activates the structure and dynamics of CDK2 kinase for catalysis. Structure. 19(5):675-90.
  • Neganova I, et al. (2011) An important role for CDK2 in G1 to S checkpoint activation and DNA damage response in human embryonic stem cells. Stem Cells. 29(4):651-9.
  • Li J, et al. (2011) Phosphorylation of MCM3 protein by cyclin E/cyclin-dependent kinase 2 (Cdk2) regulates its function in cell cycle. J Biol Chem. 286(46):39776-85.
  • Buis J, et al. (2012) Mre11 regulates CtIP-dependent double-strand break repair by interaction with CDK2. Nat Struct Mol Biol. 19(2):246-52.
  • Size / Price
    Каталог: MG50796-NM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.