CDIPT cDNA ORF Clone, Mouse, N-Myc tag

Cat: MG52580-NM

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All CDIPT Reagents

CRO Services

Product recommended


All CDIPT Reagents

CDIPT cDNA ORF Clone, Mouse, N-Myc tag General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
642 bp
Description
Full length Clone DNA of Mouse CDP-diacylglycerol--inositol 3-phosphatidyltransferase (phosphatidylinositol synthase) with N terminal Myc tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CDIPT cDNA ORF Clone, Mouse, N-Myc tag Alternative Names

9530042F15Rik cDNA ORF Clone, Mouse;D7Bwg0575e cDNA ORF Clone, Mouse;Pis cDNA ORF Clone, Mouse;Pis1 cDNA ORF Clone, Mouse

CDIPT Background Information

Full Name
CDP-diacylglycerol--inositol 3-phosphatidyltransferase

CDIPT cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
CDIPT cDNA ORF Clone in Cloning Vector, Rat RG84506-U
CDIPT Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG84506-ACGLN

CDIPT cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
CDIPT cDNA ORF Clone in Cloning Vector, Mouse MG52580-G
CDIPT cDNA ORF Clone, Mouse, untagged MG52580-UT
CDIPT Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52580-ACGLN
CDIPT cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52580-ACG
CDIPT cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52580-ANG
CDIPT cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52580-ACR
CDIPT cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52580-ANR
CDIPT cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52580-CF
CDIPT cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52580-NF
CDIPT cDNA ORF Clone, Mouse, C-His tag MG52580-CH
CDIPT cDNA ORF Clone, Mouse, N-His tag MG52580-NH
CDIPT cDNA ORF Clone, Mouse, C-HA tag MG52580-CY
CDIPT cDNA ORF Clone, Mouse, N-HA tag MG52580-NY
CDIPT cDNA ORF Clone, Mouse, C-Myc tag MG52580-CM
CDIPT qPCR Primer Pairs, Mouse MP202451

CDIPT cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CDIPT cDNA ORF Clone in Cloning Vector, Human HG16392-G
CDIPT cDNA ORF Clone, Human, untagged HG16392-UT
CDIPT Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16392-ACGLN
CDIPT cDNA ORF Clone, Human, C-GFPSpark® tag HG16392-ACG
CDIPT cDNA ORF Clone, Human, C-OFPSpark® tag HG16392-ACR
CDIPT cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16392-CF
CDIPT cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16392-NF
CDIPT cDNA ORF Clone, Human, C-His tag HG16392-CH
CDIPT cDNA ORF Clone, Human, N-His tag HG16392-NH
CDIPT cDNA ORF Clone, Human, C-HA tag HG16392-CY
CDIPT cDNA ORF Clone, Human, N-HA tag HG16392-NY
CDIPT cDNA ORF Clone, Human, C-Myc tag HG16392-CM
CDIPT cDNA ORF Clone, Human, N-Myc tag HG16392-NM
CDIPT qPCR Primer Pairs, Human HP105141
info info
添加购物车成功! 添加购物车失败!