CDIPT cDNA ORF Clone, Mouse, N-Myc tag

Price:
Size:
Number:

CDIPT cDNA ORF Clone, Mouse, N-Myc tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
642 bp
Description
Full length Clone DNA of Mouse CDP-diacylglycerol--inositol 3-phosphatidyltransferase (phosphatidylinositol synthase) with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

CDIPT cDNA ORF Clone, Mouse, N-Myc tag: Alternative Names

9530042F15Rik cDNA ORF Clone, Mouse; D7Bwg0575e cDNA ORF Clone, Mouse; Pis cDNA ORF Clone, Mouse; Pis1 cDNA ORF Clone, Mouse

CDIPT Background Information

Full Name
CDP-diacylglycerol--inositol 3-phosphatidyltransferase
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait