Быстрый заказ

Text Size:AAA

Мышь CD82/KAI-1 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse CD82 Информация о продукте «Клон cDNA»
Размер кДНК:801bp
Описание кДНК:Full length Clone DNA of Mus musculus CD82 antigen with N terminal His tag.
Синоним гена:C33, Kai1, Tspan27, AA682076, AL023070, Cd82
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Мышь CD82/KAI-1 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Мышь CD82/KAI-1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50744-ACGRBS15400
Мышь CD82/KAI-1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50744-ACRRBS15400
Мышь CD82/KAI-1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50744-CFRBS13340
Мышь CD82/KAI-1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50744-CHRBS13340
Мышь CD82/KAI-1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50744-CMRBS13340
Мышь CD82/KAI-1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50744-CYRBS13340
Мышь CD82/KAI-1 Джин клон кДНК в вектор клонированияMG50744-GRBS5130
Мышь CD82/KAI-1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50744-NFRBS13340
Мышь CD82/KAI-1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50744-NHRBS13340
Мышь CD82/KAI-1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50744-NMRBS13340
Мышь CD82/KAI-1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50744-NYRBS13340
Мышь CD82/KAI-1 Джин ORF экспрессии кДНК клона плазмидыMG50744-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

CD82, also known as KAI-1, structurally belongs to tetraspanin family while categorised as metastasis suppressor gene on functional grounds. KAI1/CD82 is localized on cell membrane and form interactions with other tetraspanins, integrins and chemokines which are respectively responsible for cell migration, adhesion and signalling. Downregulation of CD82 expression is associated with the advanced stages of many human cancers and correlates with the acquisition of metastatic potential. Recent studies suggest that complex mechanisms underlie CD82 loss of function, including altered transcriptional regulation, splice variant production and post-translational protein modifications, and indicate a central role for CD82 in controlling metastasis as a 'molecular facilitator'. The loss of KAI1/CD82 expression in invasive and metastatic cancers is due to a complex, epigenetic mechanism that probably involves transcription factors such as NFkappaB, p53, and beta-catenin. A loss of KAI1 expression is also associated with the advanced stages of many human malignancies and results in the acquisition of invasive and metastatic capabilities by tumour cells. Thus, KAI1/CD82 is regarded as a wide-spectrum tumor metastasis suppressor.

  • Malik FA, et al. (2009) KAI-1/CD82, the molecule and clinical implication in cancer and cancer metastasis. Histol Histopathol. 24(4): 519-30.
  • Liu WM, et al. (2006) KAI1/CD82, a tumor metastasis suppressor. Cancer Lett. 240(2): 183-94.
  • Tonoli H, et al. (2006) CD82 metastasis suppressor gene: a potential target for new therapeutics? Trends Mol Med. 11(12): 563-70.
  • Jackson P, et al. (2005) KAI1 tetraspanin and metastasis suppressor. Int J Biochem Cell Biol. 37(3): 530-4.
  • Size / Price
    Каталог: MG50744-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.