Быстрый заказ

Text Size:AAA

Мышь CD81/TAPA1 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse CD81 Информация о продукте «Клон cDNA»
Размер кДНК:711bp
Описание кДНК:Full length Clone DNA of Mus musculus CD81 antigen with N terminal His tag.
Синоним гена:pa1, Tapa-1, Tspan28, Cd81
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Мышь CD81/TAPA1 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Мышь CD81/TAPA1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50743-ACGRBS15400
Мышь CD81/TAPA1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50743-ACRRBS15400
Мышь CD81/TAPA1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50743-CFRBS13340
Мышь CD81/TAPA1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50743-CHRBS13340
Мышь CD81/TAPA1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50743-CMRBS13340
Мышь CD81/TAPA1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50743-CYRBS13340
Мышь CD81/TAPA1 Джин клон кДНК в вектор клонированияMG50743-GRBS5130
Мышь CD81/TAPA1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50743-NFRBS13340
Мышь CD81/TAPA1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50743-NHRBS13340
Мышь CD81/TAPA1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50743-NMRBS13340
Мышь CD81/TAPA1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50743-NYRBS13340
Мышь CD81/TAPA1 Джин ORF экспрессии кДНК клона плазмидыMG50743-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

CD81, also known as TAPA-1, belongs to the transmembrane 4 superfamily, also known as the tetraspanin family. Members of this family mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility.CD81 is a widely expressed cell-surface protein involved in an astonishing variety of biologic responses. It is related to adhesion, morphology, activation, proliferation, and differentiation of B, T, and other cells. On B cells CD81 is part of a complex with CD21, CD19, and Leu13. This complex reduces the threshold for B cell activation via the B cell receptor by bridging Ag specific recognition and CD21-mediated complement recognition.

  • Petracca R. et al., 2000, J Virol. 74 (10): 4824-30.
  • Bartosch B. et al., 2003, The Journal of Biological Chemistry. 278 (43): 41624-30.
  • Clark KL. et al., 2001, Journal of Immunology. 167 (9): 5115-21.
  • Size / Price
    Каталог: MG50743-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.