After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Мышь CD79A / Ig-alpha Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse CD79A Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_007655.3
Размер кДНК:663bp
Описание кДНК:Full length Clone DNA of Mus musculus CD79A antigen (immunoglobulin-associated alpha) with N terminal His tag.
Синоним гена:Iga, Ly54, mb-1, Ly-54, Igalpha, Ig-alpha, Cd79a
Виды:Mouse
переносчик:pCMV3-SP-N-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Мышь CD79A / Ig-alpha Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Мышь CD79A / Ig-alpha Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50734-ACGRBS15400
Мышь CD79A / Ig-alpha Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50734-ACRRBS15400
Мышь CD79A / Ig-alpha Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50734-CFRBS13340
Мышь CD79A / Ig-alpha Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50734-CHRBS13340
Мышь CD79A / Ig-alpha Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50734-CMRBS13340
Мышь CD79A / Ig-alpha Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50734-CYRBS13340
Мышь CD79A / Ig-alpha Джин клон кДНК в вектор клонированияMG50734-GRBS5130
Мышь CD79A / Ig-alpha Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50734-NFRBS13340
Мышь CD79A / Ig-alpha Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50734-NHRBS13340
Мышь CD79A / Ig-alpha Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50734-NMRBS13340
Мышь CD79A / Ig-alpha Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50734-NYRBS13340
Мышь CD79A / Ig-alpha Джин ORF экспрессии кДНК клона плазмидыMG50734-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG50734-NH
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».