Быстрый заказ

Мышь CD72 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Мышь CD72 Информация о продукте «Клон cDNA»
    Размер кДНК:1065bp
    Описание кДНК:Full length Clone DNA of Mus musculus CD72 antigen, transcript variant 2 with N terminal His tag.
    Синоним гена:CD72c, Ly-19, Ly-32, Lyb-2, Ly-m19, Cd72
    Участок рестрикции:
    Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Описание последовательности:
    ( We provide with CD72 qPCR primers for gene expression analysis, MP200707 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Мышь CD72 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
    Мышь CD72 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50732-ACGRBS15400
    Мышь CD72 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50732-ACRRBS15400
    Мышь CD72 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50732-CFRBS13340
    Мышь CD72 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50732-CHRBS13340
    Мышь CD72 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50732-CMRBS13340
    Мышь CD72 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50732-CYRBS13340
    Мышь CD72 transcript variant 2 Джин клон кДНК в вектор клонированияMG50732-GRBS5130
    Мышь CD72 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50732-NFRBS13340
    Мышь CD72 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50732-NHRBS13340
    Мышь CD72 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50732-NMRBS13340
    Мышь CD72 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50732-NYRBS13340
    Мышь CD72 transcript variant 2 Джин ORF экспрессии кДНК клона плазмидыMG50732-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: MG50732-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.