Быстрый заказ

Text Size:AAA

Мышь CD72 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse CD72 Информация о продукте «Клон cDNA»
Размер кДНК:1065bp
Описание кДНК:Full length Clone DNA of Mus musculus CD72 antigen, transcript variant 2 with N terminal His tag.
Синоним гена:CD72c, Ly-19, Ly-32, Lyb-2, Ly-m19, Cd72
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Мышь CD72 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Мышь CD72 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50732-ACGRBS15400
Мышь CD72 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50732-ACRRBS15400
Мышь CD72 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50732-CFRBS13340
Мышь CD72 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50732-CHRBS13340
Мышь CD72 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50732-CMRBS13340
Мышь CD72 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50732-CYRBS13340
Мышь CD72 transcript variant 2 Джин клон кДНК в вектор клонированияMG50732-GRBS5130
Мышь CD72 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50732-NFRBS13340
Мышь CD72 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50732-NHRBS13340
Мышь CD72 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50732-NMRBS13340
Мышь CD72 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50732-NYRBS13340
Мышь CD72 transcript variant 2 Джин ORF экспрессии кДНК клона плазмидыMG50732-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG50732-NH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.