Быстрый заказ

Мышь CD69 / CLEC2C Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse CD69 Информация о продукте «Клон cDNA»
Размер кДНК:600bp
Описание кДНК:Full length Clone DNA of Mus musculus CD69 antigen with N terminal His tag.
Синоним гена:AIM, VEA, AI452015, 5830438K24Rik, Cd69
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Мышь CD69 / CLEC2C Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Мышь CD69 / CLEC2C Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50731-ACGRBS15400
Мышь CD69 / CLEC2C Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50731-ACRRBS15400
Мышь CD69 / CLEC2C Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50731-CFRBS13340
Мышь CD69 / CLEC2C Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50731-CHRBS13340
Мышь CD69 / CLEC2C Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50731-CMRBS13340
Мышь CD69 / CLEC2C Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50731-CYRBS13340
Мышь CD69 / CLEC2C Джин клон кДНК в вектор клонированияMG50731-GRBS5130
Мышь CD69 / CLEC2C Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50731-NFRBS13340
Мышь CD69 / CLEC2C Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50731-NHRBS13340
Мышь CD69 / CLEC2C Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50731-NMRBS13340
Мышь CD69 / CLEC2C Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50731-NYRBS13340
Мышь CD69 / CLEC2C Джин ORF экспрессии кДНК клона плазмидыMG50731-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Early activation antigen CD69, also known as activation inducer molecule (AIM), is a single-pass type II membrane protein. Recently, cDNA clones encoding human and mouse CD69 were isolated and showed CD69 to be a member of the C-type lectin superfamily. It is one of the earliest cell surface antigens expressed by T cells following activation. Once expressed, CD69 acts as a costimulatory molecule for T cell activation and proliferation. In addition to mature T cells, CD69 is inducibly expressed by immature thymocytes, B cells, natural killer (NK) cells, monocytes, neutrophils and eosinophils, and is constitutively expressed by mature thymocytes and platelets. CD69 is involved in lymphocyte proliferation and functions as a signal transmitting receptor in lymphocytes, natural killer (NK) cells, and platelets. The structure, chromosomal localization, expression and function of CD69 suggest that it is likely a pleiotropic immune regulator , potentially important in the activation and differentiation of a wide variety of hematopoietic cells. This membrane molecule transiently expresses on activated lymphocytes, and its selective expression in inflammatory infiltrates suggests that it plays a role in the pathogenesis of inflammatory diseases. CD69 plays a crucial role in the pathogenesis of allergen-induced eosinophilic airway inflammation and hyperresponsiveness and that CD69 could be a possible therapeutic target for asthmatic patients.

  • Ziegler SF, et al. (1994) The activation antigen CD69. Stem Cells. 12(5): 456-65.
  • Marzio R, et al. (1999) CD69 and regulation of the immune function. Immunopharmacol Immunotoxicol. 21(3): 565-82.
  • Lamana A, et al. (2006) The role of CD69 in acute neutrophil-mediated inflammation. Eur J Immunol. 36(10): 2632-8.
  • Miki-Hosokawa T, et al. (2009) CD69 controls the pathogenesis of allergic airway inflammation. J Immunol. 183(12): 8203-15.
  • Size / Price
    Каталог: MG50731-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.