Быстрый заказ

Text Size:AAA

Мышь CD63 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse CD63 Информация о продукте «Клон cDNA»
Размер кДНК:717bp
Описание кДНК:Full length Clone DNA of Mus musculus CD63 antigen with N terminal HA tag.
Синоним гена:ME491, C75951, Tspan30, MGC103180, MGC107286, Cd63
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Мышь CD63 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
Мышь CD63 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50557-ACGRBS15400
Мышь CD63 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50557-ACRRBS15400
Мышь CD63 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG50557-ANGRBS15400
Мышь CD63 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50557-CFRBS13340
Мышь CD63 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50557-CHRBS13340
Мышь CD63 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50557-CMRBS13340
Мышь CD63 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50557-CYRBS13340
Мышь CD63 Джин клон кДНК в вектор клонированияMG50557-MRBS5130
Мышь CD63 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50557-NFRBS13340
Мышь CD63 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50557-NHRBS13340
Мышь CD63 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50557-NMRBS13340
Мышь CD63 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50557-NYRBS13340
Мышь CD63 Джин ORF экспрессии кДНК клона плазмидыMG50557-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

The cluster of differentiation (CD) system is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 320 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion. Cluster of differentiation 63 (CD63) is a member of the CD family and the transmembrane 4 superfamily,also known as the tetraspanin family. CD63 is a cellular surface glycoprotein characterized by the presence of four bydrophobic domains. CD63 had functions in mediating signal transduction processes and then regulate variety of cellular processes such as cell proliferation, activation and motility. It has reported that CD63 protein associated with tumor progression and served as a blood platlet activation marker and the deficiency of this protein may be associated with Hermansky-Pudlak syndrome.

  • Zola H, et al. (2007) CD molecules 2006-human cell differentiation molecules. J Immunol Methods. 318 (1-2): 1-5.
  • Ho IC, et al. (2009) GATA3 and the T-cell lineage: essential functions before and after T-helper-2-cell differentiation. Nat Rev Immunol. 9 (2): 125-35.
  • Matesanz-Isabel J, et al. (2011) New B-cell CD molecules. Immunology Letters.134 (2): 104-12.
  • Radford KJ, et al. (1996) Associates with Transmembrane 4 Superfamily Members, CD9 and CD81, and with beta 1 Integrins in Human Melanoma. Biochemical Biophysical Research Communications. 222(1): 13-18.
  • Metzelaar MJ, et al. (1991) CD63 antigen, A novel lysosomal membrane glycoprotein, cloned by a screening procedure for intracellular antigens in eukaryotic cells. The journal of biological chemistry. 266: 3239-45.
  • Size / Price
    Каталог: MG50557-NY
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.