CD59a cDNA ORF Clone, Mouse, N-His tag

Price:
Size:
Number:

CD59a cDNA ORF Clone, Mouse, N-His tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
372 bp
Description
Full length Clone DNA of Mouse CD59 antigen with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

CD59a cDNA ORF Clone, Mouse, N-His tag: Alternative Names

AA987121 cDNA ORF Clone, Mouse; Cd59 cDNA ORF Clone, Mouse; protectin cDNA ORF Clone, Mouse; RP24-297H17.1 cDNA ORF Clone, Mouse

CD59a Background Information

Protectin, a complement regulatory protein, also known as CD59, or MIRL (membrane inhibitor of reactive lysis) is a small protein that inhibits the complement membrane attack complex by binding C5b678 and preventing C9 from binding and polymerizing. The amino-terminal 25 amino acids represented a typical signal peptide sequence and the carboxy-terminal hydrophobic amino acids were characteristic for phosphatidylinositol-anchored proteins.It was found that the CD59/Protectin antigen is a small protein sometimes associated with larger components (45 and 8 kD) in urine. CD59/Protectin antigen was released from the surface of transfected COS cells by phosphatidylinositol-specific phospholipase C, demonstrating that it is attached to the cell membrane by means of a glycolipid anchor; it is therefore likely to be absent from the surface of affected erythrocytes in the disease paroxysmal nocturnal hemoglobinuria.
Full Name
CD59a antigen
References
  • Huang Y, et al. (2006) Defining the CD59-C9 binding interaction. J Biol Chem. 281 (37): 27398-404.
  • Sawada R, et al. (1990) Isolation and expression of the full-length cDNA encoding CD59 antigen of human lymphocytes. DNA Cell Biol. 9(3): 213-20.
  • Philbrick WM, et al. (1990) The CD59 antigen is a structural homologue of murine Ly-6 antigens but lacks interferon inducibility. Eur J Immunol. 20(1): 87-92.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait