After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь CD59a / Protectin Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse CD59A Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_007652.4
Размер кДНК:372bp
Описание кДНК:Full length Clone DNA of Mus musculus CD59 antigen with N terminal His tag.
Синоним гена:Cd59, AA987121, protectin, Cd59a
Виды:Mouse
переносчик:pCMV3-SP-N-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Мышь CD59a / Protectin Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Мышь CD59a / Protectin Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50724-ACGRBS15400
Мышь CD59a / Protectin Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50724-ACRRBS15400
Мышь CD59a / Protectin Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50724-CFRBS13340
Мышь CD59a / Protectin Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50724-CHRBS13340
Мышь CD59a / Protectin Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50724-CMRBS13340
Мышь CD59a / Protectin Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50724-CYRBS13340
Мышь CD59a / Protectin Джин клон кДНК в вектор клонированияMG50724-GRBS5130
Мышь CD59a / Protectin Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50724-NFRBS13340
Мышь CD59a / Protectin Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50724-NHRBS13340
Мышь CD59a / Protectin Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50724-NMRBS13340
Мышь CD59a / Protectin Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50724-NYRBS13340
Мышь CD59a / Protectin Джин ORF экспрессии кДНК клона плазмидыMG50724-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Protectin, a complement regulatory protein, also known as CD59, or MIRL (membrane inhibitor of reactive lysis) is a small protein that inhibits the complement membrane attack complex by binding C5b678 and preventing C9 from binding and polymerizing. The amino-terminal 25 amino acids represented a typical signal peptide sequence and the carboxy-terminal hydrophobic amino acids were characteristic for phosphatidylinositol-anchored proteins.It was found that the CD59/Protectin antigen is a small protein sometimes associated with larger components (45 and 80 kD) in urine. CD59/Protectin antigen was released from the surface of transfected COS cells by phosphatidylinositol-specific phospholipase C, demonstrating that it is attached to the cell membrane by means of a glycolipid anchor; it is therefore likely to be absent from the surface of affected erythrocytes in the disease paroxysmal nocturnal hemoglobinuria.

Ссылки
  • Huang Y, et al. (2006) Defining the CD59-C9 binding interaction. J Biol Chem. 281 (37): 27398-404.
  • Sawada R, et al. (1990) Isolation and expression of the full-length cDNA encoding CD59 antigen of human lymphocytes. DNA Cell Biol. 9(3): 213-20.
  • Philbrick WM, et al. (1990) The CD59 antigen is a structural homologue of murine Ly-6 antigens but lacks interferon inducibility. Eur J Immunol. 20(1): 87-92.
  • Size / Price
    Каталог: MG50724-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».