Быстрый заказ

Мышь CD55/DAF Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse CD55 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_010016.2
Размер кДНК:1173bp
Описание кДНК:Full length Clone DNA of Mus musculus CD55 antigen with N terminal Flag tag.
Синоним гена:Daf, Daf1, Daf-GPI, GPI-DAF, Cd55
Виды:Mouse
переносчик:pCMV3-SP-N-FLAG
Plasmid:
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Мышь CD55/DAF Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Мышь CD55/DAF Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50468-ACGRBS15400
Мышь CD55/DAF Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50468-ACRRBS15400
Мышь CD55/DAF Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50468-CFRBS13340
Мышь CD55/DAF Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50468-CHRBS13340
Мышь CD55/DAF Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50468-CMRBS13340
Мышь CD55/DAF Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50468-CYRBS13340
Мышь CD55/DAF Джин клон кДНК в вектор клонированияMG50468-MRBS5130
Мышь CD55/DAF Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50468-NFRBS13340
Мышь CD55/DAF Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50468-NHRBS13340
Мышь CD55/DAF Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50468-NMRBS13340
Мышь CD55/DAF Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50468-NYRBS13340
Мышь CD55/DAF Джин ORF экспрессии кДНК клона плазмидыMG50468-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

CD55, also well known as decay-accelerating factor (DAF), is a member of the RCA (regulators of complement activation) family characterized by four to 30 SCRs (short consensus repeats) in their plasma-exposed regions. It is a major regulator of the alternative and classical pathways of complement activation and is expressed on all serum-exposed cells. CD55 is physiologically acting as an inhibitor of the complement system, but is also broadly expressed in malignant tumours. DAF seems to exert different functions beyond its immunological role such as promotion of tumorigenesis, decrease of complement mediated tumor cell lysis, autocrine loops for cell rescue and evasion of apoptosis, neoangiogenesis, invasiveness, cell motility. It is commonly hijacked by invading pathogens, including many enteroviruses and uropathogenic Escherichia coli, to promote cellular attachment prior to infection. This 70-75 kDa glycoprotein CD55 containing four SCR modules is involved in the regulation of the complement cascade. It inhibits complement activation by suppressing the function of C3/C5 convertases, thereby limiting local generation or deposition of C3a/C5a and membrane attack complex (MAC or C5b-9) production. DAF has been identified as a ligand for an activation-associated, seven-transmembrane lymphocyte receptor, CD97, which is a receptor mediating attachment and infection of several viruses and bacteria. In addition, it has been shown that DAF regulates the interplay between complement and T cell immunity in vivo, and thus may be implicated in immune and tumor biology.

Ссылки
  • Lea S. (2002) Interactions of CD55 with non-complement ligands. Biochem Soc Trans. 30(Pt 6): 1014-9.
  • Mikesch JH, et al. (2006) The expression and action of decay-accelerating factor (CD55) in human malignancies and cancer therapy. Cell Oncol. 28(5-6): 223-32.
  • Wang Y, et al. (2010) Decay accelerating factor (CD55) protects neuronal cells from chemical hypoxia-induced injury. J Neuroinflammation. 7:24.
  • Size / Price
    Каталог: MG50468-NF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».