Быстрый заказ

Text Size:AAA

Мышь ICAM-1/CD54 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse ICAM1 Информация о продукте «Клон cDNA»
Размер кДНК:1614bp
Описание кДНК:Full length Clone DNA of Mus musculus intercellular adhesion molecule 1 with N terminal Flag tag.
Синоним гена:CD54, Ly-47, Icam-1, MALA-2, MGC6195, Icam1
Участок рестрикции:KpnI + XbaI (6kb + 1.62kb)
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Mouse ICAM1 Gene Plasmid Map
Mouse CD54 / ICAM1 natural ORF mammalian expression plasmid, N-Flag tag
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Мышь ICAM-1/CD54 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Мышь ICAM-1/CD54 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50440-ACGRBS16764
Мышь ICAM-1/CD54 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50440-ACRRBS16764
Мышь ICAM-1/CD54 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50440-CFRBS14711
Мышь ICAM-1/CD54 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50440-CHRBS14711
Мышь ICAM-1/CD54 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50440-CMRBS14711
Мышь ICAM-1/CD54 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50440-CYRBS14711
Мышь ICAM-1/CD54 Джин клон кДНК в вектор клонированияMG50440-MRBS5132
Мышь ICAM-1/CD54 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50440-NFRBS14711
Мышь ICAM-1/CD54 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50440-NHRBS14711
Мышь ICAM-1/CD54 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50440-NMRBS14711
Мышь ICAM-1/CD54 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50440-NYRBS14711
Мышь ICAM-1/CD54 Джин ORF экспрессии кДНК клона плазмидыMG50440-UTRBS14711
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Intercellular adhesion molecule-1 (ICAM-1, or CD54) is a 90 kDa member of the immunoglobulin (Ig) superfamily and is critical for the firm arrest and transmigration of leukocytes out of blood vessels and into tissues. ICAM-1 is constitutively present on endothelial cells, but its expression is increased by proinflammatory cytokines. The endothelial expression of ICAM-1 is increased in atherosclerotic and transplant-associated atherosclerotic tissue and in animal models of atherosclerosis. Additionally, ICAM-1 has been implicated in the progression of autoimmune diseases. ICAM-1 is a ligand for LFA-1(integrin). When activated, leukocytes bind to endothelial cells via ICAM-1/LFA-1 interaction and then transmigrate into tissues. Presence with heavy glycosylation and other structural characteristics, ICAM-1 possesses binding sites for a number of immune-associated ligands and serves as the binding site for entry of the major group of human Rhinovirus (HRV) into various cell types. ICAM-1 also becomes known for its affinity for Plasmodium falciparum-infected erythrocytes (PFIE), providing more of a role in infectious disease. Previous studies have shown that ICAM-1 is involved in inflammatory reactions and that a defect in ICAM-1 gene inhibits allergic contact hypersensitivity.

  • Xu H, et al. (2001) The role of ICAM-1 molecule in the migration of Langerhans cells in the skin and regional lymph node. Eur J Immunol. 31(10): 3085-93.
  • Terol MJ, et al. (2003) Soluble intercellular adhesion molecule-1 (s-ICAM-1/s-CD54) in diffuse large B-cell lymphoma: association with clinical characteristics and outcome. Ann Oncol. 14(3): 467-74.
  • Mendez MP, et al. (2006) Shedding of soluble ICAM-1 into the alveolar space in murine models of acute lung injury. Am J Physiol Lung Cell Mol Physiol. 290(5): L962-70.
  • Lawson C, et al. (2009) ICAM-1 signaling in endothelial cells. Pharmacol Rep. 61(1): 22-32.
  • Size / Price
    Каталог: MG50440-NF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    НаличиеIn Stock
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    • Mouse CD54 / ICAM1 natural ORF mammalian expression plasmid, N-Flag tag
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.