After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь CD5 / Cluster of Differentiation 5 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse CD5 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_007650.3
Размер кДНК:1485bp
Описание кДНК:Full length Clone DNA of Mus musculus CD5 antigen with C terminal Flag tag.
Синоним гена:Ly-1, Ly-A, Ly-12, Lyt-1, Cd5
Виды:Mouse
переносчик:pCMV3-C-FLAG
Plasmid:pCMV3-mCD5-Flag
Участок рестрикции:KpnI + XbaI (6kb + 1.52kb)
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 192G>A not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Mouse CD5 Gene Plasmid Map
Mouse CD5 natural ORF mammalian expression plasmid, C-Flag tag
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Мышь CD5 / Cluster of Differentiation 5 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
Мышь CD5 / Cluster of Differentiation 5 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50403-ACGRBS15396
Мышь CD5 / Cluster of Differentiation 5 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50403-ACRRBS15396
Мышь CD5 / Cluster of Differentiation 5 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50403-CFRBS13343
Мышь CD5 / Cluster of Differentiation 5 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50403-CHRBS13343
Мышь CD5 / Cluster of Differentiation 5 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50403-CMRBS13343
Мышь CD5 / Cluster of Differentiation 5 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50403-CYRBS13343
Мышь CD5 / Cluster of Differentiation 5 Джин клон кДНК в вектор клонированияMG50403-MRBS5132
Мышь CD5 / Cluster of Differentiation 5 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50403-NFRBS13343
Мышь CD5 / Cluster of Differentiation 5 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50403-NHRBS13343
Мышь CD5 / Cluster of Differentiation 5 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50403-NMRBS13343
Мышь CD5 / Cluster of Differentiation 5 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50403-NYRBS13343
Мышь CD5 / Cluster of Differentiation 5 Джин ORF экспрессии кДНК клона плазмидыMG50403-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

The cluster of differentiation (CD) system is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 320 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion. CD5 is a member of the CD system. CD5 was found to be widely distributed in T-cells and B1 cells which is a subset of IgM-secreting B cells. CD5 also was found expressed in small lymphocytic lymphoma, hairy cell leukaemia and mantle cell lymphoma cells. CD5 serves to weaken the activating stimulus from the BCR so that the B1 cells can only reflect to the very strong stimuli but not the normal tissue proteins.

Ссылки
  • Zola H, et al. (2007) CD molecules 2006-human cell differentiation molecules. J Immunol Methods. 318 (1-2): 1-5.
  • Ho IC, et al. (2009) GATA3 and the T-cell lineage: essential functions before and after T-helper-2-cell differentiation. Nat Rev Immunol. 9 (2): 125-35.
  • Matesanz-Isabel J, et al. (2011) New B-cell CD molecules. Immunology Letters. 134 (2): 104-12.
  • Kirchgessner H, et al. (2001) The transmembrane adaptor protein TRIM regulates T cell receptor (TCR) expression and TCR-mediated signaling via an association with the TCR zeta chain. J Exp Med. 193 (11): 1269-84.
  • Size / Price
    Каталог: MG50403-CF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    НаличиеIn Stock
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
    • Human NQO1 ORF mammalian expression plasmid, C-Flag tag
    • Mouse CD5 natural ORF mammalian expression plasmid, C-Flag tag
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».