After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Мышь CD48/Blast-1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse CD48 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_007649.4
Размер кДНК:723bp
Описание кДНК:Full length Clone DNA of Mus musculus CD48 antigen with C terminal Flag tag.
Синоним гена:BCM1, BLAST, Bcm-1, BLAST1, SLAMF2, Sgp-60, BLAST-1, MEM-102, AI449234, AW610730, Cd48
Виды:Mouse
переносчик:pCMV3-C-FLAG
Plasmid:pCMV3-mCD48-Flag
Участок рестрикции:HindIII + XbaI (6kb + 0.76kb)
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Mouse CD48 Gene Plasmid Map
Mouse CD48 natural ORF mammalian expression plasmid, C-Flag tag
Mouse CD48 Gene Expression validated Image
Mouse CD48 ORF mammalian expression plasmid, C-Flag tag
[Щелкните, чтобы увеличить изображение]
Caption:
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Мышь CD48/Blast-1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
Мышь CD48/Blast-1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50415-ACGRBS15396
Мышь CD48/Blast-1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50415-ACRRBS15396
Мышь CD48/Blast-1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50415-CFRBS13343
Мышь CD48/Blast-1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50415-CHRBS13343
Мышь CD48/Blast-1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50415-CMRBS13343
Мышь CD48/Blast-1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50415-CYRBS13343
Мышь CD48/Blast-1 Джин клон кДНК в вектор клонированияMG50415-MRBS5132
Мышь CD48/Blast-1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50415-NFRBS13343
Мышь CD48/Blast-1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50415-NHRBS13343
Мышь CD48/Blast-1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50415-NMRBS13343
Мышь CD48/Blast-1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50415-NYRBS13343
Мышь CD48/Blast-1 Джин ORF экспрессии кДНК клона плазмидыMG50415-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Cluster of Differentiation 48 (CD48), also known as SLAMF2, BCM-1 and BLAST-1, is a GPI-linked protein belonging to the CD2 subfamily of immunoglobulin superfamily molecules. CD2 and 2B4 (CD244) are known ligands for CD48. CD48 protein is expressed on most lineage-committed hematopoietic cells but not on hematopoietic stem cells or multipotent hematopoietic progenitors. CD48 protein performs biological functions in a variety processes including adhesion, pathogen recognition, cellular activation, and cytokine regulation, and emerges as a critical effector molecule in immune responses.

Ссылки
  • Messmer B, et al. (2006) CD48 stimulation by 2B4 (CD244)-expressing targets activates human NK cells. J Immunol. 176(8): 4646-50
  • Milstein O, et al. (2008) Nanoscale increases in CD2-CD48-mediated intermembrane spacing decrease adhesion and reorganize the immunological synapse. J Biol Chem. 283(49): 34414-22.
  • Size / Price
    Каталог: MG50415-CF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    НаличиеIn Stock
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
    • Mouse CD48 natural ORF mammalian expression plasmid, C-Flag tag
    • Mouse CD48 ORF mammalian expression plasmid, C-Flag tag
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».