Быстрый заказ

Text Size:AAA

Мышь CD40 Ligand/CD40L/CD154 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse CD40LG Информация о продукте «Клон cDNA»
Размер кДНК:783bp
Описание кДНК:Full length Clone DNA of Mus musculus CD40 ligand with C terminal Myc tag.
Синоним гена:IGM; IMD3; Ly62; TRAP; gp39; CD154; Cd40l; HIGM1; Ly-62; T-BAM; CD40-L; Tnfsf5
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Мышь CD40 Ligand/CD40L/CD154 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка on other vectors
Мышь CD40 Ligand/CD40L/CD154 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50327-ACGRBS15400
Мышь CD40 Ligand/CD40L/CD154 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50327-ACRRBS15400
Мышь CD40 Ligand/CD40L/CD154 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50327-CFRBS13340
Мышь CD40 Ligand/CD40L/CD154 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50327-CHRBS13340
Мышь CD40 Ligand/CD40L/CD154 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50327-CMRBS13340
Мышь CD40 Ligand/CD40L/CD154 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50327-CYRBS13340
Мышь CD40 Ligand/CD40L/CD154 Джин клон кДНК в вектор клонированияMG50327-GRBS5130
Мышь CD40 Ligand/CD40L/CD154 Джин клон кДНК в вектор клонированияMG50327-MRBS5130
Мышь CD40 Ligand/CD40L/CD154 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50327-NFRBS13340
Мышь CD40 Ligand/CD40L/CD154 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50327-NHRBS13340
Мышь CD40 Ligand/CD40L/CD154 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50327-NMRBS13340
Мышь CD40 Ligand/CD40L/CD154 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50327-NYRBS13340
Мышь CD40 Ligand/CD40L/CD154 Джин ORF экспрессии кДНК клона плазмидыMG50327-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

The cluster of differentiation (CD) system is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 320 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion. CD154, also known as CD40 ligand or CD40L, is a member of the TNF superfamily. While CD154 was originally found on T cell surface, its expression has since been found on a wide variety of cells, including platelets, mast cells, macrophages and NK cells. CD154's ability is achieved through binding to the CD40 on antigen- presenting cells (APC). In the macrophage cells, the primary signal for activation is IFN-γ from Th1 type CD4 T cells. The secondary signal is CD40L on the T cell, which interacting with the CD40 molecules, helping increase the level of activation.

  • Zola H, et al. (2007) CD molecules 2006-human cell differentiation molecules. J Immunol Methods. 318 (1-2): 1-5.
  • Ho IC, et al. (2009) GATA3 and the T-cell lineage: essential functions before and after T-helper-2-cell differentiation. Nat Rev Immunol. 9 (2): 125-35.
  • Matesanz-Isabel J, et al. (2011) New B-cell CD molecules. Immunology Letters.134 (2): 104-12.
  • Grewal IS, et al. (1998) CD40 and CD154 in cell-mediated immunity. Annual Review of Immunology. 16: 111-35.
  • Size / Price
    Каталог: MG50327-CM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.