Быстрый заказ

Text Size:AAA

Мышь CD31/PECAM-1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse PECAM1 Информация о продукте «Клон cDNA»
Размер кДНК:2184bp
Описание кДНК:Full length Clone DNA of Mus musculus platelet/endothelial cell adhesion molecule 1 with C terminal Flag tag.
Синоним гена:Cd31, Pecam, C85791, PECAM-1, MGC102160, Pecam1
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Мышь CD31/PECAM-1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
Мышь CD31/PECAM-1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50408-ACGRBS16760
Мышь CD31/PECAM-1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50408-ACRRBS16760
Мышь CD31/PECAM-1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50408-CFRBS14710
Мышь CD31/PECAM-1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50408-CHRBS14710
Мышь CD31/PECAM-1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50408-CMRBS14710
Мышь CD31/PECAM-1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50408-CYRBS14710
Мышь CD31/PECAM-1 Джин клон кДНК в вектор клонированияMG50408-MRBS5130
Мышь CD31/PECAM-1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50408-NFRBS14710
Мышь CD31/PECAM-1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50408-NHRBS14710
Мышь CD31/PECAM-1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50408-NMRBS14710
Мышь CD31/PECAM-1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50408-NYRBS14710
Мышь CD31/PECAM-1 Джин ORF экспрессии кДНК клона плазмидыMG50408-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name

The Cluster of Differentiation 31 (CD31) adhesion molecule, also known as platelet-endothelial cell adhesion molecule-1 (PECAM-1), is the only known member of the CAM family on platelets. CD31 protein is a 130-kDa transmembrane glycoprotein expressed by endothelial cells, platelets, monocytes, neutrophils, and certain T cell subsets. CD31 protein is also expressed in certain tumors, including epithelioid hemangioendothelioma, other vascular tumors, and histiocytic malignancies. CD31 plays a key role in removing aged neutrophils and tissue regeneration. CD31 protein mediates the homotypic or heterotypic cell adhesion by binding to itself or the leukocyte integrin αvβ3, and thus plays a role in neutrophil recruitment in inflammatory responses, transendothelial migration of leukocytes, as well as in cardiovascular development.

  • Deaglio S, et al. (2000) CD38/CD31, a receptor/ligand system ruling adhesion and signaling in human leukocytes. Chem Immunol. 75: 99-120.
  • Kohler S, et al. (2009) Life after the thymus: CD31+ and CD31- human naive CD4+ T-cell subsets. Blood. 113(4): 769-74.
  • Size / Price
    Каталог: MG50408-CF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.