CD27 cDNA ORF Clone, Mouse, N-His tag

1/1
Price:
Size:
Number:

CD27 cDNA ORF Clone, Mouse, N-His tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
753 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse CD27 antigen, transcript variant 1 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Restriction Sites
KpnI + XbaI (6kb + 0.84kb)
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

CD27 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CD27 cDNA ORF Clone, Mouse, N-His tag: Validated Images

CD27 cDNA ORF Clone, Mouse, N-His tag: Alternative Names

S152 cDNA ORF Clone, Mouse; Tnfrsf7 cDNA ORF Clone, Mouse; Tp55 cDNA ORF Clone, Mouse

CD27 Background Information

CD27, also known as TNFRSF7, is a member of the TNF-receptor superfamily limited to cells of the lymphoid lineage, and exists as both a dimeric glycoprotein on the cell surface and as a soluble protein in serum. As a type I transmembrane glycoprotein of about 55 kDa existing as disulfide-linked homodimer, CD27 has been shown to play roles in lymphoid proliferation, differentiation, and apoptosis.It has important role in generation of T cell immunity, and is an apparently robust marker for normal memory B cells. It is a T and B cell co-stimulatory molecule, the activity of CD27 is governed by its TNF-like ligand CD7 on lymphocytes and dendritic cells. The CD27-CD7 interaction is required for Th1 generation responses to differentiation signals and long-term maintenance of T cell immunity, and meanwhile, plays a key role in regulating B-cell differentiation, activation and immunoglobulin synthesis.
Full Name
CD27 molecule
Research Areas
References
  • Drner T, et al. (2004) Correlation of circulating CD27 high plasma cells and disease activity in systemic lupus erythematosus. Lupus. 13(5): 283-9.
  • Sahota SS, et al. (2009) CD27 in defining memory B-cell origins in Waldenstrm's macroglobulinemia. Clin Lymphoma Myeloma. 9(1): 33-5.
  • Jiang J, et al. (2010) Reduced CD27 expression on antigen-specific CD4+ T cells correlates with persistent active tuberculosis. J Clin Immunol. 30(4): 566-73.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait