After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь CD207/Langerin Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse CD207 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_144943.2
Размер кДНК:996bp
Описание кДНК:Full length Clone DNA of Mus musculus CD207 antigen.
Синоним гена:CD207
Виды:Mouse
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Мышь CD207/Langerin Джин ORF экспрессии кДНК клона плазмиды on other vectors
Мышь CD207/Langerin Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50285-ACGRBS15400
Мышь CD207/Langerin Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50285-ACRRBS15400
Мышь CD207/Langerin Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50285-CFRBS13340
Мышь CD207/Langerin Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50285-CHRBS13340
Мышь CD207/Langerin Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50285-CMRBS13340
Мышь CD207/Langerin Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50285-CYRBS13340
Мышь CD207/Langerin Джин клон кДНК в вектор клонированияMG50285-MRBS5130
Мышь CD207/Langerin Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50285-NFRBS13340
Мышь CD207/Langerin Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50285-NHRBS13340
Мышь CD207/Langerin Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50285-NMRBS13340
Мышь CD207/Langerin Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50285-NYRBS13340
Мышь CD207/Langerin Джин ORF экспрессии кДНК клона плазмидыMG50285-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG50285-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».