After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь CD200R1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse CD200R1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_021325.3
Размер кДНК:981bp
Описание кДНК:Full length Clone DNA of Mus musculus CD200 receptor 1 with N terminal Myc tag.
Синоним гена:OX2R, Mox2r, CD200R, Cd200r1
Виды:Mouse
переносчик:pCMV3-SP-N-Myc
Plasmid:
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Мышь CD200R1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Мышь CD200R1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50209-ACGRBS15400
Мышь CD200R1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50209-ACRRBS15400
Мышь CD200R1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50209-CFRBS13340
Мышь CD200R1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50209-CHRBS13340
Мышь CD200R1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50209-CMRBS13340
Мышь CD200R1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50209-CYRBS13340
Мышь CD200R1 Джин клон кДНК в вектор клонированияMG50209-MRBS5130
Мышь CD200R1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50209-NFRBS13340
Мышь CD200R1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50209-NHRBS13340
Мышь CD200R1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50209-NMRBS13340
Мышь CD200R1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50209-NYRBS13340
Мышь CD200R1 Джин ORF экспрессии кДНК клона плазмидыMG50209-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

The cluster of differentiation (CD) system is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 320 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion. Cell surface glycoprotein CD200 receptor 1 (CD200R1) is an isoform of CD200 receptors which is expressed on cells of the myeloid lineage. CD200R1 is a receptor for the OX-2 membrane glycoprotein. The receptor-substrate interaction may serve as a myeloid downregulatory signal.

Ссылки
  • Zola H, et al. (2007) CD molecules 2006-human cell differentiation molecules. J Immunol Methods. 318 (1-2): 1-5.
  • Ho IC, et al. (2009) GATA3 and the T-cell lineage: essential functions before and after T-helper-2-cell differentiation. Nat Rev Immunol. 9 (2): 125-35.
  • Matesanz-Isabel J, et al. (2011) New B-cell CD molecules. Immunology Letters.134 (2): 104-12.
  • Size / Price
    Каталог: MG50209-NM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».