CD2 cDNA ORF Clone, Mouse, N-HA tag

Price:
Size:
Number:

CD2 cDNA ORF Clone, Mouse, N-HA tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1035 bp
Description
Full length Clone DNA of Mouse CD2 antigen with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

CD2 cDNA ORF Clone, Mouse, N-HA tag: Alternative Names

LFA-2 cDNA ORF Clone, Mouse; Ly-37 cDNA ORF Clone, Mouse; Ly37 cDNA ORF Clone, Mouse

CD2 Background Information

T-cell surface antigen CD2, also known as T-cell surface antigen T11/Leu-5, and SRBC, is a single-pass type I membrane protein. It contains one Ig-like C2-type domain and one Ig-like V-type domain. CD2 is a cell adhesion molecule expressed on T cells and is recognized as a target for CD48 (rats) and CD58 (humans). CD2 has been shown to set quantitative thresholds in T cell activation both in vivo and in vitro. Further, intracellular CD2 signaling pathways and networks are being discovered by the identification of several cytosolic tail binding proteins. CD2 interacts with lymphocyte function-associated antigen (LFA-3) and CD48/BCM1 to mediate adhesion between T-cells and other cell types. CD2 is implicated in the triggering of T-cells, the cytoplasmic domain of CD2 is implicated in the signaling function. The complex of CD2 and CD58 also plays an important role in enhancing the adhesion of T lymphocytes to target cells, and promoting hyperplasia and activation of T lymphocytes. As a cell surface glycoprotein, CD2 expressed on most human T cells and natural killer (NK) cells and plays an important role in mediating cell adhesion in both T-lymphocytes and in signal transduction.
Full Name
CD2 molecule
References
  • Yang JJ, et al. (2001) Structural biology of the cell adhesion protein CD2: alternatively folded states and structure-function relation. Curr Protein Pept Sci. 2(1): 1-17.
  • Wilkins AL, et al. (2003) Structural biology of the cell adhesion protein CD2: from molecular recognition to protein folding and design. Curr Protein Pept Sci. 4(5): 367-73.
  • McNerney ME, et al. (2006) The CD2 family of natural killer cell receptors. Curr Top Microbiol Immunol. 298: 91-120.

CD2 cDNA ORF Clone, Canine, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait