After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Мышь CD19/B4/CVID3 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse CD19 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_009844.2
Размер кДНК:1644bp
Описание кДНК:Full length Clone DNA of Mus musculus CD19 antigen with C terminal HA tag.
Синоним гена:AW495831, Cd19
Виды:Mouse
переносчик:pCMV3-C-HA
Plasmid:pCMV3-mCD19-HA
Участок рестрикции:HindIII + XbaI (6kb + 1.69kb)
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Mouse CD19 Gene Plasmid Map
Mouse CD19 ORF mammalian expression plasmid, C-HA tag
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Мышь CD19/B4/CVID3 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Мышь CD19/B4/CVID3 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50510-ACGRBS16760
Мышь CD19/B4/CVID3 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50510-ACRRBS16760
Мышь CD19/B4/CVID3 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50510-CFRBS14710
Мышь CD19/B4/CVID3 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50510-CHRBS14710
Мышь CD19/B4/CVID3 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50510-CMRBS14710
Мышь CD19/B4/CVID3 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50510-CYRBS14710
Мышь CD19/B4/CVID3 Джин клон кДНК в вектор клонированияMG50510-MRBS5130
Мышь CD19/B4/CVID3 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50510-NFRBS14710
Мышь CD19/B4/CVID3 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50510-NHRBS14710
Мышь CD19/B4/CVID3 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50510-NMRBS14710
Мышь CD19/B4/CVID3 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50510-NYRBS14710
Мышь CD19/B4/CVID3 Джин ORF экспрессии кДНК клона плазмидыMG50510-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

The cluster of differentiation (CD) system is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 320 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion. Cluster of differentiation 19 (CD19) is a member of CD system. CD19 is a cell surface molecule that assembles with the antigen receptor of B-cells. This results in a descent in threshold for antigen receptor-dependent stimulation. A simplified view holds that the ability of B-cells to respond to the various antigens in a specific and sensitive manner is achieved in the presence of low-affinity antigen receptors. CD19 primarily acts as a B-cell coreceptor in conjunction with CD21 and CD81. The formation of the receptor complex is induced by antigen and CD19, induced by exogenous antigen, has been found cytoplasmic tail phosphorylated and bind to sIg.

Ссылки
  • Zola H, et al. (2007) CD molecules 2006-human cell differentiation molecules. J Immunol Methods. 318 (1-2): 1-5.
  • Ho IC, et al. (2009) GATA3 and the T-cell lineage: essential functions before and after T-helper-2-cell differentiation. Nat Rev Immunol. 9 (2): 125-35.
  • Matesanz-Isabel J, et al. (2011) New B-cell CD molecules. Immunology Letters.134 (2): 104-12.
  • Carter RH, et al. (1992) CD19: lowering the threshold for antigen receptor stimulation of B lymphocytes. Science. 256 (5053): 105-7.
  • Size / Price
    Каталог: MG50510-CY
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    НаличиеIn Stock
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
    • Mouse CD19 ORF mammalian expression plasmid, C-HA tag
    • Cynomolgus CD19/B4/CVID3 Gene Plasmid Map 5622
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».