After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь CD180/RP105 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse CD180 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_008533.2
Размер кДНК:1986bp
Описание кДНК:Full length Clone DNA of Mus musculus CD180 antigen with C terminal HA tag.
Синоним гена:Ly78, RP105, F630107B15
Виды:Mouse
переносчик:pCMV3-C-HA
Plasmid:
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Мышь CD180/RP105 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Мышь CD180/RP105 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50491-ACGRBS16760
Мышь CD180/RP105 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50491-ACRRBS16760
Мышь CD180/RP105 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50491-CFRBS14710
Мышь CD180/RP105 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50491-CHRBS14710
Мышь CD180/RP105 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50491-CMRBS14710
Мышь CD180/RP105 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50491-CYRBS14710
Мышь CD180/RP105 Джин клон кДНК в вектор клонированияMG50491-MRBS5130
Мышь CD180/RP105 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50491-NFRBS14710
Мышь CD180/RP105 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50491-NHRBS14710
Мышь CD180/RP105 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50491-NMRBS14710
Мышь CD180/RP105 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50491-NYRBS14710
Мышь CD180/RP105 Джин ORF экспрессии кДНК клона плазмидыMG50491-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

The cluster of differentiation (CD) system is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 320 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion. CD180, also known as RP105, is a B-cell surface molecule belonging to the family of pathogen receptors, Toll-like receptors (TLR). CD180 has an extracellular leucine-rich repeats and a short cytoplasmic tail. CD180 / RP105 interact with an extracellular molecule named MD1 and then together form the cell surface receptor complex RP105 / MD1 which induces B-cell activation in humans and mice, leading to proliferation and up-regulation of a costimulatory molecule, B7.2 / CD86. CD180 / RP105 also has a role in LPS response because B cells lacking RP105 show hyporesponsiveness to LPS.

Ссылки
  • Zola H, et al. (2007) CD molecules 2006-human cell differentiation molecules. J Immunol Methods. 318 (1-2): 1-5.
  • Ho IC, et al. (2009) GATA3 and the T-cell lineage: essential functions before and after T-helper-2-cell differentiation. Nat Rev Immunol. 9 (2): 125-35.
  • Matesanz-Isabel J, et al. (2011) New B-cell CD molecules. Immunology Letters.134 (2): 104-12.
  • Nagai Y, et al. (2002) Requirement for MD-1 in cell surface expression of RP105/CD180 and B-cell responsiveness to lipopolysaccharide. Journal of the American society of hematology. 99(5): 1699-705.
  • Size / Price
    Каталог: MG50491-CY
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».