Быстрый заказ

Мышь CD163 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

  • Mouse CD163 natural ORF mammalian expression plasmid, N-Flag tag
ПаспортОбзорыСвязанные продуктыПротоколы
Мышь CD163 Информация о продукте «Клон cDNA»
Размер кДНК:3366bp
Описание кДНК:Full length Clone DNA of Mus musculus CD163 antigen with N terminal Flag tag.
Синоним гена:CD163v2, CD163v3
Участок рестрикции:KpnI + XbaI (6kb + 3.34kb)
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 1056 T/C, 2052 T/C not causing the amino acid variation.
( We provide with CD163 qPCR primers for gene expression analysis, MP201015 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Мышь CD163 Gene Plasmid Map
Mouse CD163 natural ORF mammalian expression plasmid, N-Flag tag
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Мышь CD163 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Мышь CD163 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51057-ACGRBS22240
Мышь CD163 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51057-ACRRBS22240
Мышь CD163 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51057-CFRBS20190
Мышь CD163 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51057-CHRBS20190
Мышь CD163 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51057-CMRBS20190
Мышь CD163 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51057-CYRBS20190
Мышь CD163 Джин клон кДНК в вектор клонированияMG51057-GRBS5130
Мышь CD163 Джин ORF экспрессии кДНК клона плазмидыMG51057-G-NRBS20190
Мышь CD163 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51057-NFRBS20190
Мышь CD163 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51057-NHRBS20190
Мышь CD163 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51057-NMRBS20190
Мышь CD163 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51057-NYRBS20190
Мышь CD163 Джин ORF экспрессии кДНК клона плазмидыMG51057-UTRBS20190
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG51057-NF
Цена по прейскуранту: 
Цена:      (You Save: )

Datasheet & Documentation

Contact Us
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.