CD157 cDNA ORF Clone, Mouse, C-Myc tag

Price:
Size:
Number:

CD157 cDNA ORF Clone, Mouse, C-Myc tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
936 bp
Description
Full length Clone DNA of Mouse bone marrow stromal cell antigen 1 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

CD157 cDNA ORF Clone, Mouse, C-Myc tag: Alternative Names

114/A10 cDNA ORF Clone, Mouse; A530073F09 cDNA ORF Clone, Mouse; BP-3 cDNA ORF Clone, Mouse; Bp3 cDNA ORF Clone, Mouse; Bsta1 cDNA ORF Clone, Mouse; CD157 cDNA ORF Clone, Mouse; Ly65 cDNA ORF Clone, Mouse

CD157 Background Information

The cluster of differentiation (CD) system is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 32 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion. CD157, also known as ADP-ribosyl cyclase 2, is an ectoenzyme sharing several characteristics with ADP-ribosyl cyclase CD38. CD157 was originally identified as a bone marrow stromal cell molecule (BST-1) with a glycosylphosphatidylinositol (GPI) anchor to bind to the cell surface. CD157 is prevalently expressed by cells of the myeloid lineage. CD157 could act as a receptor with signal transduction capability. Further, it regulates calcium homeostasis and promotes polarization in neutrophils and mediates superoxide (O2−) production in the human U937 myeloid line.
Full Name
bone marrow stromal cell antigen 1
References
  • Zola H, et al. (2007) CD molecules 2006-human cell differentiation molecules. J Immunol Methods. 318 (1-2): 1-5.
  • Ho IC, et al. (2009) GATA3 and the T-cell lineage: essential functions before and after T-helper-2-cell differentiation. Nat Rev Immunol. 9 (2): 125-35.
  • Matesanz-Isabel J, et al. (2011) New B-cell CD molecules. Immunology Letters.134 (2): 104-12.
  • Malavasi F, et al. (2006) CD38 and CD157 as Receptors of the Immune System: A Bridge Between Innate and Adaptive Immunity. Molecular Medicine. 12 (11-12): 334-41.
  • Ortolan E, et al. (2002) CD157, the janus of CD38 but with a unique personality. Cell Biochemistry and Function. 20 (4): 309-22.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait