CD155 / PVR cDNA ORF Clone, Mouse, untagged

1/1
Price:
Size:
Number:

CD155 / PVR cDNA ORF Clone, Mouse, untagged: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1227 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse poliovirus receptor.
Plasmid
Promoter
Enhanced CMV promoter
Restriction Sites
KpnI (two restriction sites) + XbaI (6.10kb + 0.63kb + 0.6kb)
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

CD155 / PVR cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CD155 / PVR cDNA ORF Clone, Mouse, untagged: Validated Images

CD155 / PVR cDNA ORF Clone, Mouse, untagged: Alternative Names

3830421F03Rik cDNA ORF Clone, Mouse; CD155 cDNA ORF Clone, Mouse; D7Ertd458e cDNA ORF Clone, Mouse; HVED cDNA ORF Clone, Mouse; mE4 cDNA ORF Clone, Mouse; necl-5 cDNA ORF Clone, Mouse; PVS cDNA ORF Clone, Mouse; Taa1 cDNA ORF Clone, Mouse; Tage4 cDNA ORF Clone, Mouse

CD155 / PVR Background Information

CD155, commonly known as PVR (poliovirus receptor) and Necl-5 (nectin-like molecule-5), is a type I transmembrane single-span glycoprotein, and belongs to the nectins and nectin-like (Necl) subfamily. CD155 was originally identified based on its ability to mediate the cell attachment and entry of poliovirus (PV), an etiologic agent of the central nervous system disease poliomyelitis. The normal cellular function is in the establishment of intercellular adherens junctions between epithelial cells. CD155 may assist in an efficient humoral immune response generated within the intestinal immune system. It has been demonstrated that CD155 can be recognized and bond by DNAM-1 and CD96 which promote the adhension, migration and NK-cell killing, and thus efficiently prime cell-mediated tumor-specific immunity.
Full Name
poliovirus receptor
References
  • Freistadt MS, et al. (2000) Hematopoietic cells from CD155-transgenic mice express CD155 and support poliovirus replication ex vivo. Microb Pathog. 29(4): 203-12.
  • Sato T, et al. (2004) Involvement of heterophilic trans-interaction of Necl-5/Tage4/PVR/CD155 with nectin-3 in formation of nectin- and cadherin-based adherens junctions. Genes Cells. 9(9): 791-9.
  • Kakunaga S, et al. (2004) Enhancement of serum- and platelet-derived growth factor-induced cell proliferation by Necl-5/Tage4/poliovirus receptor/CD155 through the Ras-Raf-MEK-ERK signaling. J Biol Chem. 279(35): 36419-25.
  • Sato T, et al. (2005) Common signaling pathway is used by the trans-interaction of Necl-5/Tage4/PVR/CD155 and nectin, and of nectin and nectin during the formation of cell-cell adhesion. Cancer Sci. 96(9): 578-89.
  • Minami Y, et al. (2007) Involvement of up-regulated Necl-5/Tage4/PVR/CD155 in the loss of contact inhibition in transformed NIH3T3 cells. Biochem Biophys Res Commun. 352(4): 856-60.

CD155 / PVR cDNA ORF Clone, Human, Related Products

  • CD155 loss enhances tumor suppression via combined host and tumor-intrinsic mechanisms
    Author
    Li, XY;Das, I;Lepletier, A;Addala, V;Bald, T;Stannard, K;Barkauskas, D;Liu, J;Aguilera, AR;Takeda, K;Braun, M;Nakamura, K;Jacquelin, S;Lane, SW;Teng, MW;Dougall, WC;Smyth, MJ;
    Year
    2018
    Journal
    J. Clin. Invest.
    Application
    expression
Add to Cart Successfully Add to Cart Failed