CD147 cDNA ORF Clone, Mouse, C-Myc tag

Price:
Size:
Number:

CD147 cDNA ORF Clone, Mouse, C-Myc tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
822 bp
Description
Full length Clone DNA of Mouse basigin, transcript variant 2 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

CD147 cDNA ORF Clone, Mouse, C-Myc tag: Alternative Names

AI115436 cDNA ORF Clone, Mouse; AI325119 cDNA ORF Clone, Mouse; CD147 cDNA ORF Clone, Mouse; EMMPRIN cDNA ORF Clone, Mouse; HT-7 cDNA ORF Clone, Mouse

CD147 Background Information

CD147/EMMPRIN (Extracellular Matrix Metalloproteinase Inducer), also known as Basigin (BSG), is a transmembrane glycoprotein with different forms resulted from different modes of glycosylation and N-terminal sequence variants. It is a member of the immunoglobulin superfamily with homology to both the immunoglobulin V domain and MHC class II antigen beta-chain. This protein play important roles in variety of events including spermatogenesis, embryo implantation, neural network formation. CD147 induces the production and release of matrix metalloproteinases (MMP) in the surrounding mesenchymal cells and tumor cells, and thereby promotes invasion, metastasis, growth and survival of malignant cells. Furthermore, CD147 also serves as a receptor for extracellular cyclophilinthe and its association with integrins might be important in signal transduction. Recently, CD147 displays increased expression in many cancers, and it has been previously demonstrated to participate in cancer metastasis and progression. Thus, CD147 and its antibody are used as an effective treatment for malignant cancers.
Full Name
basigin (Ok blood group)
References
  • Tang Y, et al. (2004) Tumor-stroma interaction: positive feedback regulation of extracellular matrix metalloproteinase inducer (EMMPRIN) expression and matrix metalloproteinase-dependent generation of soluble EMMPRIN. Mol Cancer Res. 2(2): 73-80.
  • Wilson MC, et al. (2005) Basigin (CD147) is the target for organomercurial inhibition of monocarboxylate transporter isoforms 1 and 4: the ancillary protein for the insensitive MCT2 is EMBIGIN (gp70). J Biol Chem. 280(29): 27213-21.
  • Curtin KD, et al. (2005) Basigin (EMMPRIN/CD147) interacts with integrin to affect cellular architecture. J Cell Sci. 118(Pt 12): 2649-60.
  • Zhu H, et al. (2009) A novel antibody fragment targeting HAb18G/CD147 with cytotoxicity and decreased immunogenicity. Cancer Biol Ther. 8(11): 1035-44. Zhu H, et al. (2009) A novel antibody fragment targeting HAb18G/CD147 with cytotoxicity and decreased immunogenicity. Cancer Biol Ther. 8(11): 1035-44.
  • Seizer P, et al. (2009) EMMPRIN (CD147) is a novel receptor for platelet GPVI and mediates platelet rolling via GPVI-EMMPRIN interaction. Thromb Haemost. 101(4): 682-6.
  • Moonsom S, et al. (2010) A Competitive ELISA for Quantifying Serum CD147: Reduction of Soluble CD147 Levels in Cancer Patient Sera. Hybridoma (Larchmt). 29(1): 45-52.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait