After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Мышь CD147/EMMPRIN/Basigin transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse BSG Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001077184.1
Размер кДНК:822bp
Описание кДНК:Full length Clone DNA of Mus musculus basigin, transcript variant 2 with C terminal Myc tag.
Синоним гена:HT-7, CD147, EMMPRIN, AI115436, AI325119, Bsg
Виды:Mouse
переносчик:pCMV3-C-Myc
Plasmid:
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Мышь CD147/EMMPRIN/Basigin transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка on other vectors
Мышь CD147/EMMPRIN/Basigin transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50332-ACGRBS15400
Мышь CD147/EMMPRIN/Basigin transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50332-ACRRBS15400
Мышь CD147/EMMPRIN/Basigin transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50332-CFRBS13340
Мышь CD147/EMMPRIN/Basigin transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50332-CHRBS13340
Мышь CD147/EMMPRIN/Basigin transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50332-CMRBS13340
Мышь CD147/EMMPRIN/Basigin transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50332-CYRBS13340
Мышь CD147/EMMPRIN/Basigin transcript variant 2 Джин клон кДНК в вектор клонированияMG50332-MRBS5130
Мышь CD147/EMMPRIN/Basigin transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50332-NFRBS13340
Мышь CD147/EMMPRIN/Basigin transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50332-NHRBS13340
Мышь CD147/EMMPRIN/Basigin transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50332-NMRBS13340
Мышь CD147/EMMPRIN/Basigin transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50332-NYRBS13340
Мышь CD147/EMMPRIN/Basigin transcript variant 2 Джин ORF экспрессии кДНК клона плазмидыMG50332-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

CD147/EMMPRIN (Extracellular Matrix Metalloproteinase Inducer), also known as Basigin (BSG), is a transmembrane glycoprotein with different forms resulted from different modes of glycosylation and N-terminal sequence variants. It is a member of the immunoglobulin superfamily with homology to both the immunoglobulin V domain and MHC class II antigen beta-chain. This protein play important roles in variety of events including spermatogenesis, embryo implantation, neural network formation. CD147 induces the production and release of matrix metalloproteinases (MMP) in the surrounding mesenchymal cells and tumor cells, and thereby promotes invasion, metastasis, growth and survival of malignant cells. Furthermore, CD147 also serves as a receptor for extracellular cyclophilinthe and its association with integrins might be important in signal transduction. Recently, CD147 displays increased expression in many cancers, and it has been previously demonstrated to participate in cancer metastasis and progression. Thus, CD147 and its antibody are used as an effective treatment for malignant cancers.

Ссылки
  • Tang Y, et al. (2004) Tumor-stroma interaction: positive feedback regulation of extracellular matrix metalloproteinase inducer (EMMPRIN) expression and matrix metalloproteinase-dependent generation of soluble EMMPRIN. Mol Cancer Res. 2(2): 73-80.
  • Wilson MC, et al. (2005) Basigin (CD147) is the target for organomercurial inhibition of monocarboxylate transporter isoforms 1 and 4: the ancillary protein for the insensitive MCT2 is EMBIGIN (gp70). J Biol Chem. 280(29): 27213-21.
  • Curtin KD, et al. (2005) Basigin (EMMPRIN/CD147) interacts with integrin to affect cellular architecture. J Cell Sci. 118(Pt 12): 2649-60.
  • Zhu H, et al. (2009) A novel antibody fragment targeting HAb18G/CD147 with cytotoxicity and decreased immunogenicity. Cancer Biol Ther. 8(11): 1035-44. Zhu H, et al. (2009) A novel antibody fragment targeting HAb18G/CD147 with cytotoxicity and decreased immunogenicity. Cancer Biol Ther. 8(11): 1035-44.
  • Seizer P, et al. (2009) EMMPRIN (CD147) is a novel receptor for platelet GPVI and mediates platelet rolling via GPVI-EMMPRIN interaction. Thromb Haemost. 101(4): 682-6.
  • Moonsom S, et al. (2010) A Competitive ELISA for Quantifying Serum CD147: Reduction of Soluble CD147 Levels in Cancer Patient Sera. Hybridoma (Larchmt). 29(1): 45-52.
  • Size / Price
    Каталог: MG50332-CM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».