After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Мышь VE-Cadherin/CD144 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse CDH5 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_009868.4
Размер кДНК:2355bp
Описание кДНК:Full length Clone DNA of Mus musculus cadherin 5 with N terminal Myc tag.
Синоним гена:7B4, Vec, Cd144, VE-Cad, AA408225, Cdh5
Виды:Mouse
переносчик:pCMV3-SP-N-Myc
Plasmid:
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Мышь VE-Cadherin/CD144 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Мышь VE-Cadherin/CD144 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50192-ACGRBS16764
Мышь VE-Cadherin/CD144 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50192-ACRRBS16764
Мышь VE-Cadherin/CD144 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50192-CFRBS14711
Мышь VE-Cadherin/CD144 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50192-CHRBS14711
Мышь VE-Cadherin/CD144 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50192-CMRBS14711
Мышь VE-Cadherin/CD144 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50192-CYRBS14711
Мышь VE-Cadherin/CD144 Джин клон кДНК в вектор клонированияMG50192-MRBS5132
Мышь VE-Cadherin/CD144 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50192-NFRBS14711
Мышь VE-Cadherin/CD144 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50192-NHRBS14711
Мышь VE-Cadherin/CD144 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50192-NMRBS14711
Мышь VE-Cadherin/CD144 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50192-NYRBS14711
Мышь VE-Cadherin/CD144 Джин ORF экспрессии кДНК клона плазмидыMG50192-UTRBS14711
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Cadherins (Calcium dependent adhesion molecules) are a class of transmembrane proteins. Cadherin-5, also known as VE-cadherin, CDH5 and CD144, an endothelial specific cell-cell adhesion molecule, plays a pivotal role in the formation, maturation and remodeling of the vascular wall. VE-Cadherin is widely considered to be specific for vascular endothelia in which it is either the sole or the predominant cadherin, often co-existing with N-cadherin. This specificity of VE-cadherin for vascular endothelial cells is important not only in blood and lymph vessel biology and medicine, but also for cell-type-based diagnoses, notably those of metastatic tumors. As a classical cadherin, VE-Cadherin links endothelial cells together by homophilic interactions mediated by its extracellular part and associates intracellularly with the actin cytoskeleton via catenins. Mechanisms that regulate VE-cadherin-mediated adhesion are important for the control of vascular permeability and leukocyte extravasation. In addition to its adhesive functions, VE-Cadherin regulates various cellular processes such as cell proliferation and apoptosis and modulates vascular endothelial growth factor receptor functions. Consequently, VE-cadherin is essential during embryonic angiogenesis.

Ссылки
  • Taveau JC, et al. (2008) Structure of artificial and natural VE-cadherin-based adherens junctions. Biochem Soc Trans. 36(Pt 2): 189-93.
  • Vestweber D. (2008) VE-cadherin: the major endothelial adhesion molecule controlling cellular junctions and blood vessel formation. Arterioscler Thromb Vasc Biol. 28(2): 223-32.
  • Gavard J. (2009) Breaking the VE-cadherin bonds. FEBS Lett. 583(1): 1-6.
  • Vestweber D, et al. (2009) Cell adhesion dynamics at endothelial junctions: VE-cadherin as a major player. Trends Cell Biol. 19(1): 8-15.
  • Boda-Heggemann J, et al. (2009) Beyond vessels: occurrence and regional clustering of vascular endothelial (VE-)cadherin-containing junctions in non-endothelial cells. Cell Tissue Res. 335(1): 49-65.
  • Size / Price
    Каталог: MG50192-NM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».