After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь CD112/Nectin-2/PVRL2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse PVRL2 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_008990.2
Размер кДНК:1594bp
Описание кДНК:Full length Clone DNA of Mus musculus poliovirus receptor-related 2 with C terminal Myc tag.
Синоним гена:MPH, Pvr, Pvs, Cd112, AI325026, AI987993, nectin-2, Pvrl2
Виды:Mouse
переносчик:pCMV3-C-Myc
Plasmid:
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Мышь CD112/Nectin-2/PVRL2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка on other vectors
Мышь CD112/Nectin-2/PVRL2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50318-ACGRBS16760
Мышь CD112/Nectin-2/PVRL2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50318-ACRRBS16760
Мышь CD112/Nectin-2/PVRL2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50318-CFRBS14710
Мышь CD112/Nectin-2/PVRL2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50318-CHRBS14710
Мышь CD112/Nectin-2/PVRL2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50318-CMRBS14710
Мышь CD112/Nectin-2/PVRL2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50318-CYRBS14710
Мышь CD112/Nectin-2/PVRL2 Джин клон кДНК в вектор клонированияMG50318-MRBS5130
Мышь CD112/Nectin-2/PVRL2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50318-NFRBS14710
Мышь CD112/Nectin-2/PVRL2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50318-NHRBS14710
Мышь CD112/Nectin-2/PVRL2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50318-NMRBS14710
Мышь CD112/Nectin-2/PVRL2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50318-NYRBS14710
Мышь CD112/Nectin-2/PVRL2 Джин ORF экспрессии кДНК клона плазмидыMG50318-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Cluster of Differentiation 112 (CD112), also known as poliovirus receptor related protein 2 (PVRL2 or PRR2), is a single-pass type I transmembrane glycoprotein belonging to the Immunoglobulin superfamily. CD112 protein also serves as an entry for certain mutant strains of herpes simplex virus and pseudorabies virus, and thus is involved in cell to cell spreading of these viruses. CD112 protein has been identified as the ligand for DNAM-1 (CD226), and the interaction of CD226/CD112 protein can induce NK cell- and CD8+ T cell-mediated cytotoxicity and cytokine secretion. CD112 has been regarded as a critical component in allergic reactions, and accordingly may function as a novel target for anti-allergic therapy.

Ссылки
  • Bachelet I, et al. (2006) Mast cell costimulation by CD226/CD112 (DNAM-1/Nectin-2): a novel interface in the allergic process. J Biol Chem. 281(37): 27190-6.
  • Wang L, et al. (2009) Molecular cloning, characterization and three-dimensional modeling of porcine nectin-2/CD112. Vet Immunol Immunopathol. 132(2-4): 257-63.
  • Size / Price
    Каталог: MG50318-CM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».