After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Мышь cyclin D2/CCND2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse CCND2 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_009829.3
Размер кДНК:870bp
Описание кДНК:Full length Clone DNA of Mus musculus cyclin D2 with C terminal Flag tag.
Синоним гена:cD2; Vin1; Vin-1; C86853; AI256817; BF642806; 2600016F06Rik
Виды:Mouse
переносчик:pCMV3-C-FLAG
Plasmid:
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Мышь cyclin D2/CCND2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
Мышь cyclin D2/CCND2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51009-ACGRBS15396
Мышь cyclin D2/CCND2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51009-ACRRBS15396
Мышь cyclin D2/CCND2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51009-ANGRBS15396
Мышь cyclin D2/CCND2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51009-ANRRBS15396
Мышь cyclin D2/CCND2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51009-CFRBS13343
Мышь cyclin D2/CCND2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51009-CHRBS13343
Мышь cyclin D2/CCND2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51009-CMRBS13343
Мышь cyclin D2/CCND2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51009-CYRBS13343
Mouse CCND2 Gene cDNA clone plasmidMG51009-GRBS3620
Мышь cyclin D2/CCND2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51009-NFRBS13343
Мышь cyclin D2/CCND2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51009-NHRBS13343
Мышь cyclin D2/CCND2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51009-NMRBS13343
Мышь cyclin D2/CCND2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51009-NYRBS13343
Мышь cyclin D2/CCND2 Джин клон кДНК в вектор клонированияMG51009-URBS5132
Мышь cyclin D2/CCND2 Джин ORF экспрессии кДНК клона плазмидыMG51009-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG51009-CF
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».