Быстрый заказ

Мышь CCL3/Mip1a Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse CCL3 Информация о продукте «Клон cDNA»
Размер кДНК:279bp
Описание кДНК:Full length Clone DNA of Mus musculus chemokine (C-C motif) ligand 3 with C terminal HA tag.
Синоним гена:RP23-320E6.7, AI323804, G0S19-1, LD78alpha, MIP-1alpha, MIP1-(a), MIP1-alpha, Mip1a, Scya3
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Мышь CCL3/Mip1a Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Мышь CCL3/Mip1a Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51114-ACGRBS15400
Мышь CCL3/Mip1a Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51114-ACRRBS15400
Мышь CCL3/Mip1a Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51114-CFRBS13340
Мышь CCL3/Mip1a Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51114-CHRBS13340
Мышь CCL3/Mip1a Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51114-CMRBS13340
Мышь CCL3/Mip1a Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51114-CYRBS13340
Мышь CCL3/Mip1a Джин клон кДНК в вектор клонированияMG51114-GRBS5130
Мышь CCL3/Mip1a Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51114-NFRBS13340
Мышь CCL3/Mip1a Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51114-NHRBS13340
Мышь CCL3/Mip1a Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51114-NMRBS13340
Мышь CCL3/Mip1a Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51114-NYRBS13340
Мышь CCL3/Mip1a Джин ORF экспрессии кДНК клона плазмидыMG51114-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

CCL3 is a cytokine belonging to the CC chemokine family. Chemokines are a family of structurally related leukocyte chemoattractant cytokines that play a central role during immunoregulatory and inflammation processes. All chemokines contain four conserved cysteines linked by disulfide bonds, and two major subfamilies, namely CXC and CC, are defined on the basis of the first two cysteines which are separated by one amino acid or are adjacent. CCL3 is involved in the acute inflammatory state in the recruitment and activation of polymorphonuclear leukocytes.

  • Zhao RY, et al. (2005) Viral infections and cell cycle G2/M regulation. Cell Res. 15(3):143-9. Joseph AM, et al. (2005) Nef: "necessary and enforcing factor" in HIV infection. Curr HIV Res. 3(1):87-94. Muthumani K, et al. (2004) HIV-1 Vpr and anti-inflammatory activity. DNA Cell Biol. 23(4): 239-47.
  • Size / Price
    Каталог: MG51114-CY
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.