Быстрый заказ

Text Size:AAA

Мышь CCL28/SCYA28 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse CCL28 Информация о продукте «Клон cDNA»
Размер кДНК:393bp
Описание кДНК:Full length Clone DNA of Mus musculus chemokine (C-C motif) ligand 28 with N terminal His tag.
Синоним гена:MEC, CCK1, Scya28, Ccl28
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Мышь CCL28/SCYA28 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Мышь CCL28/SCYA28 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50107-ACGRBS15400
Мышь CCL28/SCYA28 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50107-ACRRBS15400
Мышь CCL28/SCYA28 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50107-CFRBS13340
Мышь CCL28/SCYA28 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50107-CHRBS13340
Мышь CCL28/SCYA28 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50107-CMRBS13340
Мышь CCL28/SCYA28 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50107-CYRBS13340
Мышь CCL28/SCYA28 Джин клон кДНК в вектор клонированияMG50107-MRBS5130
Мышь CCL28/SCYA28 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50107-NFRBS13340
Мышь CCL28/SCYA28 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50107-NHRBS13340
Мышь CCL28/SCYA28 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50107-NMRBS13340
Мышь CCL28/SCYA28 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50107-NYRBS13340
Мышь CCL28/SCYA28 Джин ORF экспрессии кДНК клона плазмидыMG50107-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG50107-NH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.