Быстрый заказ

Мышь CCL25/TECK Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse CCL25 Информация о продукте «Клон cDNA»
Размер кДНК:435bp
Описание кДНК:Full length Clone DNA of Mus musculus chemokine (C-C motif) ligand 25 with N terminal His tag.
Синоним гена:TECK, CKb15, Scya25, AI852536, Ccl25
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Мышь CCL25/TECK Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Мышь CCL25/TECK Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50109-ACGRBS15400
Мышь CCL25/TECK Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50109-ACRRBS15400
Мышь CCL25/TECK Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50109-CFRBS13340
Мышь CCL25/TECK Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50109-CHRBS13340
Мышь CCL25/TECK Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50109-CMRBS13340
Мышь CCL25/TECK Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50109-CYRBS13340
Мышь CCL25/TECK Джин клон кДНК в вектор клонированияMG50109-MRBS5130
Мышь CCL25/TECK Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50109-NFRBS13340
Мышь CCL25/TECK Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50109-NHRBS13340
Мышь CCL25/TECK Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50109-NMRBS13340
Мышь CCL25/TECK Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50109-NYRBS13340
Мышь CCL25/TECK Джин ORF экспрессии кДНК клона плазмидыMG50109-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG50109-NH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.