HP1 Alpha / CBX5 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag

Price:
Size:
Number:

HP1 Alpha / CBX5 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
576 bp
Description
Full length Clone DNA of Mouse chromobox 5 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

HP1 Alpha / CBX5 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag: Alternative Names

2610029O15Rik cDNA ORF Clone, Mouse; C75991 cDNA ORF Clone, Mouse; HP1 cDNA ORF Clone, Mouse; Hp1a cDNA ORF Clone, Mouse; Hp1alpha cDNA ORF Clone, Mouse

HP1 Alpha / CBX5 Background Information

Chromobox 5 (CBX5) is a putative target of CDC7 and genetic silencing of CBX5 also results in increased Endo18 and collagen uptake. Finally, CRISPR-mediated activation of Endo18 expression results in increased collagen uptake, suggesting that CDC7 regulates collagen internalization through increased Endo18 expression. Targeting the regulatory elements of the collagen degradative machinery may be a useful therapeutic approach in diseases of fibrosis or malignancy. The three members of the human heterochromatin protein 1 (HP1) family of proteins, HP1α, HP1β, and HPγ, are involved in chromatin packing and epigenetic gene regulation. HP1α is encoded from the CBX5 gene and is a suppressor of metastasis. CBX5 is down-regulated at the transcriptional and protein level in metastatic compared to non-metastatic breast cancer. CBX5 shares a bi-directional promoter structure with the hnRNPA1 gene. But whereas CBX5 expression is down-regulated in metastatic cells, hnRNAP1 expression is constant. Heterochromatin protein 1α (HP1α) encoded from the CBX5-gene is an evolutionary conserved protein that binds histone H3 di- or tri-methylated at position lysine 9 (H3K9me2/3), a hallmark for heterochromatin, and has an essential role in forming higher order chromatin structures. HP1α has diverse functions in heterochromatin formation, gene regulation, and mitotic progression, and forms complex networks of gene, RNA, and protein interactions. Emerging evidence has shown that HP1α serves a unique biological role in breast cancer related processes and in particular for epigenetic control mechanisms involved in aberrant cell proliferation and metastasis.
Full Name
chromobox homolog 5
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait