Быстрый заказ

Мышь HP1 alpha/CBX5 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse CBX5 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001076789.1
Размер кДНК:576bp
Описание кДНК:Full length Clone DNA of Mus musculus chromobox 5 with C terminal Myc tag.
Синоним гена:HP1, Hp1a, C75991, Hp1alpha, 2610029O15Rik
Виды:Mouse
переносчик:pCMV3-C-Myc
Plasmid:
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Мышь HP1 alpha/CBX5 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка on other vectors
Мышь HP1 alpha/CBX5 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51641-ACGRBS15400
Мышь HP1 alpha/CBX5 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51641-ACRRBS15400
Мышь HP1 alpha/CBX5 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51641-ANGRBS15400
Мышь HP1 alpha/CBX5 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51641-ANRRBS15400
Мышь HP1 alpha/CBX5 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51641-CFRBS13340
Мышь HP1 alpha/CBX5 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51641-CHRBS13340
Мышь HP1 alpha/CBX5 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51641-CMRBS13340
Мышь HP1 alpha/CBX5 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51641-CYRBS13340
Мышь HP1 alpha/CBX5 Джин клон кДНК в вектор клонированияMG51641-GRBS5130
Мышь HP1 alpha/CBX5 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51641-NFRBS13340
Мышь HP1 alpha/CBX5 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51641-NHRBS13340
Мышь HP1 alpha/CBX5 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51641-NMRBS13340
Мышь HP1 alpha/CBX5 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51641-NYRBS13340
Мышь HP1 alpha/CBX5 Джин ORF экспрессии кДНК клона плазмидыMG51641-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG51641-CM
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».