After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь CAMKI/CAMK1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse CAMK1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_133926.2
Размер кДНК:1125bp
Описание кДНК:Full length Clone DNA of Mus musculus calcium/calmodulin-dependent protein kinase I with C terminal Myc tag.
Синоним гена:AI505105, CaMKIalpha, D6Ertd263e
Виды:Mouse
переносчик:pCMV3-C-Myc
Plasmid:
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Мышь CAMKI/CAMK1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка on other vectors
Мышь CAMKI/CAMK1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG52781-ACGRBS15400
Мышь CAMKI/CAMK1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG52781-ACRRBS15400
Мышь CAMKI/CAMK1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG52781-ANGRBS15400
Мышь CAMKI/CAMK1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG52781-ANRRBS15400
Мышь CAMKI/CAMK1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG52781-CFRBS13340
Мышь CAMKI/CAMK1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG52781-CHRBS13340
Мышь CAMKI/CAMK1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG52781-CMRBS13340
Мышь CAMKI/CAMK1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG52781-CYRBS13340
Мышь CAMKI/CAMK1 Джин клон кДНК в вектор клонированияMG52781-GRBS5130
Мышь CAMKI/CAMK1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG52781-NFRBS13340
Мышь CAMKI/CAMK1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG52781-NHRBS13340
Мышь CAMKI/CAMK1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG52781-NMRBS13340
Мышь CAMKI/CAMK1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG52781-NYRBS13340
Мышь CAMKI/CAMK1 Джин ORF экспрессии кДНК клона плазмидыMG52781-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Calcium/calmodulin-dependent protein kinase or CaM kinases are serine/threonine-specific protein kinases that are primarily regulated by the Calcium/calmodulin complex. These kinases show a memory effect on activation. CaM kinases activity can outlast the intracellular calcium transient that is needed to activate it. In neurons, this property is important for the induction of synaptic plasticity. Pharmacological inhibition of CaM kinases II blocks the induction of long-term potentiation. Upon activation, CaM kinases II phosphorylates postsynaptic glutamate receptors and changes the electrical properties of the synapse.

Calcium/calmodulin-dependent protein kinase type 1D, also known as CaM kinase I delta, CaM kinase ID, CaMKI-like protein kinase, CKLiK and CAMK1D, is a member of the protein kinase superfamily and CaMK subfamily. It contains one protein kinase domain. CAMK1D is broadly expressed. It is highly and mostly expressed in polymorphonuclear leukocytes (neutrophilic and eosinophilic granulocytes) while little or no expression is observed in monocytes and lymphocytes. Engineered overexpression of CAMK1D in non-tumorigenic breast epithelial cells led to increased cell proliferation, and molecular and phenotypic alterations indicative of epithelial-mesenchymal transition (EMT), including loss of cell-cell adhesions and increased cell migration and invasion. CAMK1D is a potential therapeutic target with particular relevance to clinically unfavorable basal-like tumors.

Ссылки
  • Lisman, JE. et al., 1985, Proc Natl Acad Sci USA. 82 (9): 3055-7.
  • Bergamaschi, A. et al., 2008, Mol Oncol. 2 (4): 327-39.
  • White RB. et al., 2008, Physiological genomics, 33 (1): 41-9.
  • Schleinitz, D. et al., 2010, Horm Metab Res. 42 (1): 14-22.
  • Size / Price
    Каталог: MG52781-CM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».