After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь Calmodulin 2 / CALM2 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse CALM2 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_007589.5
Размер кДНК:450bp
Описание кДНК:Full length Clone DNA of Mus musculus calmodulin 2.
Синоним гена:AL024017, 1500001E21Rik
Виды:Mouse
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Мышь Calmodulin 2 / CALM2 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Мышь Calmodulin 2 / CALM2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51329-ACGRBS15396
Мышь Calmodulin 2 / CALM2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51329-ACRRBS15396
Мышь Calmodulin 2 / CALM2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51329-ANGRBS15396
Мышь Calmodulin 2 / CALM2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51329-ANRRBS15396
Мышь Calmodulin 2 / CALM2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51329-CFRBS13343
Мышь Calmodulin 2 / CALM2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51329-CHRBS13343
Мышь Calmodulin 2 / CALM2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51329-CMRBS13343
Мышь Calmodulin 2 / CALM2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51329-CYRBS13343
Мышь Calmodulin 2 / CALM2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51329-NFRBS13343
Мышь Calmodulin 2 / CALM2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51329-NHRBS13343
Мышь Calmodulin 2 / CALM2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51329-NMRBS13343
Мышь Calmodulin 2 / CALM2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51329-NYRBS13343
Мышь Calmodulin 2 / CALM2 Джин клон кДНК в вектор клонированияMG51329-URBS5132
Мышь Calmodulin 2 / CALM2 Джин ORF экспрессии кДНК клона плазмидыMG51329-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Calmodulin 2, also known as CALM2, is a calmodulin. Calmodulin 2 mediates the control of a large number of enzymes, ion channels and other proteins by Ca(2+). It is involved in a genetic pathway that regulates the centrosome cycle and progression through cytokinesis. Calmodulin 2 gene may be a genetic determinant of hip osteoarthritis (OA). OA is a degenerative disease characterized by gradual loss of articular cartilage and is a leading cause of disability in elderly populations. CALM2 was most abundantly expressed in articular chondrocytes and OA cartilage.

Ссылки
  • Egli R, et al. (1993) Localization of the human bona fide calmodulin genes CALM1, CALM2, and CALM3 to chromosomes 14q24-q31, 2p21.1-p21.3, and 19q13.2-q13.3. Genomics. 16(2): 461-5.
  • Mikiko, et al. (2002) Centrosomal proteins CG-NAP and kendrin provide microtubule nucleation sites by anchoring gamma-tubulin ring complex. Mol Biol Cell. 13(9):3235-45.
  • SenGupta B, et al. (1987) Molecular analysis of human and rat calmodulin complementary DNA clones. Evidence for additional active genes in these species. J Biol Chem. 262(34): 16663-70.
  • Size / Price
    Каталог: MG51329-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».