Быстрый заказ

Мышь Calmodulin 2 / CALM2 Джин ORF экспрессии кДНК клона плазмиды

    ПаспортОбзорыСвязанные продуктыПротоколы
    Мышь CALM2 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_007589.5
    Размер кДНК:450bp
    Описание кДНК:Full length Clone DNA of Mus musculus calmodulin 2.
    Синоним гена:AL024017, 1500001E21Rik
    Виды:Mouse
    переносчик:pCMV3-untagged
    Plasmid:
    Участок рестрикции:
    Последовательность меток:
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with CALM2 qPCR primers for gene expression analysis, MP201206 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Мышь Calmodulin 2 / CALM2 Джин ORF экспрессии кДНК клона плазмиды on other vectors
    Мышь Calmodulin 2 / CALM2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51329-ACGRBS15400
    Мышь Calmodulin 2 / CALM2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51329-ACRRBS15400
    Мышь Calmodulin 2 / CALM2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51329-ANGRBS15400
    Мышь Calmodulin 2 / CALM2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51329-ANRRBS15400
    Мышь Calmodulin 2 / CALM2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51329-CFRBS13340
    Мышь Calmodulin 2 / CALM2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51329-CHRBS13340
    Мышь Calmodulin 2 / CALM2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51329-CMRBS13340
    Мышь Calmodulin 2 / CALM2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51329-CYRBS13340
    Мышь Calmodulin 2 / CALM2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51329-NFRBS13340
    Мышь Calmodulin 2 / CALM2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51329-NHRBS13340
    Мышь Calmodulin 2 / CALM2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51329-NMRBS13340
    Мышь Calmodulin 2 / CALM2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51329-NYRBS13340
    Мышь Calmodulin 2 / CALM2 Джин клон кДНК в вектор клонированияMG51329-URBS5130
    Мышь Calmodulin 2 / CALM2 Джин ORF экспрессии кДНК клона плазмидыMG51329-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Фон

    Calmodulin 2, also known as CALM2, is a calmodulin. Calmodulin 2 mediates the control of a large number of enzymes, ion channels and other proteins by Ca(2+). It is involved in a genetic pathway that regulates the centrosome cycle and progression through cytokinesis. Calmodulin 2 gene may be a genetic determinant of hip osteoarthritis (OA). OA is a degenerative disease characterized by gradual loss of articular cartilage and is a leading cause of disability in elderly populations. CALM2 was most abundantly expressed in articular chondrocytes and OA cartilage.

    Ссылки
  • Egli R, et al. (1993) Localization of the human bona fide calmodulin genes CALM1, CALM2, and CALM3 to chromosomes 14q24-q31, 2p21.1-p21.3, and 19q13.2-q13.3. Genomics. 16(2): 461-5.
  • Mikiko, et al. (2002) Centrosomal proteins CG-NAP and kendrin provide microtubule nucleation sites by anchoring gamma-tubulin ring complex. Mol Biol Cell. 13(9):3235-45.
  • SenGupta B, et al. (1987) Molecular analysis of human and rat calmodulin complementary DNA clones. Evidence for additional active genes in these species. J Biol Chem. 262(34): 16663-70.
  • Size / Price
    Каталог: MG51329-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».