After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь CADM4/IGSF4C/NECL-4 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse CADM4 Информация о продукте «Клон cDNA»
Размер кДНК:1167bp
Описание кДНК:Full length Clone DNA of Mus musculus cell adhesion molecule 4 with C terminal HA tag.
Синоним гена:Tsll2, Igdf4c, Igsf4c, Cadm4
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Мышь CADM4/IGSF4C/NECL-4 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Мышь CADM4/IGSF4C/NECL-4 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50501-ACGRBS15400
Мышь CADM4/IGSF4C/NECL-4 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50501-ACRRBS15400
Мышь CADM4/IGSF4C/NECL-4 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50501-CFRBS13340
Мышь CADM4/IGSF4C/NECL-4 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50501-CHRBS13340
Мышь CADM4/IGSF4C/NECL-4 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50501-CMRBS13340
Мышь CADM4/IGSF4C/NECL-4 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50501-CYRBS13340
Мышь CADM4/IGSF4C/NECL-4 Джин клон кДНК в вектор клонированияMG50501-MRBS5130
Мышь CADM4/IGSF4C/NECL-4 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50501-NFRBS13340
Мышь CADM4/IGSF4C/NECL-4 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50501-NHRBS13340
Мышь CADM4/IGSF4C/NECL-4 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50501-NMRBS13340
Мышь CADM4/IGSF4C/NECL-4 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50501-NYRBS13340
Мышь CADM4/IGSF4C/NECL-4 Джин ORF экспрессии кДНК клона плазмидыMG50501-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Immunoglobulin superfamily member 4C (IGSF4C), also known as CADM4 or NECL-4, is an immunoglobulin (Ig) superfamily molecule showing significant homology with a lung tumor suppressor, TSLC1. CADM4/IGSF4C/NECL-4 protein is mainly expressed in the kidney, bladder, and prostate in addition to the brain. Experiments have reported the biological significance of CADM4/IGSF4C/NECL-4 in the urinary tissues. An immunohistochemical study reveals that CADM4 is expressed at the cell-cell attachment sites in the renal tubules, the transitional epithelia of the bladder, and the glandular epithelia of the prostate. IGSF4-immunoreactivity (IR) was observed diffusely in the telencephalic wall, whereas it became rather confined to the subplate, the cortical plate and the subventricular zone as the development proceeded. IGSF4-IR gradually decreased after birth and disappeared in adulthood. IGSF4 remained at low levels throughout embryonic stage, whereas it increased after birth. These spatiotemporal patterns of the expression suggest that IGSF4 plays crucial roles in the development of both telencephalon and cerebellum. CADM4/IGSF4C/NECL-4 is ectopically expressed in adult T-cell leukemia (ATL) cells, providing not only a diagnostic marker for ATL, but also a possible therapeutic target against its invasion. The distinct roles of CADM4/IGSF4C/NECL-4 in the oncogenesis of carcinomas and ATL could be due to tissue-specific differences in the downstream cascades, and is a novel concept with respect to cell adhesion in human oncogenesis.

  • Williams YN, et al. (2006) Cell adhesion and prostate tumor-suppressor activity of TSLL2/IGSF4C, an immunoglobulin superfamily molecule homologous to TSLC1/IGSF4. Oncogene. 25(10): 1446-53.
  • Ohta Y, et al. (2005) Spatiotemporal patterns of expression of IGSF4 in developing mouse nervous system. Brain Res Dev Brain Res. 156(1): 23-31.
  • Shingai T, et al. (2003) Implications of nectin-like molecule-2 /IGSF4 /RA175 /SgIGSF /TSLC1 /SynCAM1 in cell-cell adhesion and transmembrane protein localization in epithelial cells. J Biol Chem. 278(37): 35421-7.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.