CADM1 cDNA ORF Clone, Mouse, N-HA tag

Price:
Size:
Number:

CADM1 cDNA ORF Clone, Mouse, N-HA tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1338 bp
Description
Full length Clone DNA of Mouse cell adhesion molecule 1 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

CADM1 cDNA ORF Clone, Mouse, N-HA tag: Alternative Names

2900073G06Rik cDNA ORF Clone, Mouse; 3100001I08Rik cDNA ORF Clone, Mouse; AI987920 cDNA ORF Clone, Mouse; Bl2 cDNA ORF Clone, Mouse; Igsf4 cDNA ORF Clone, Mouse; Igsf4a cDNA ORF Clone, Mouse; Necl2 cDNA ORF Clone, Mouse; RA175 cDNA ORF Clone, Mouse; RA175A cDNA ORF Clone, Mouse; RA175B cDNA ORF Clone, Mouse; RA175C cDNA ORF Clone, Mouse; RA175N cDNA ORF Clone, Mouse; SgIGSF cDNA ORF Clone, Mouse; ST17 cDNA ORF Clone, Mouse; SynCam cDNA ORF Clone, Mouse; Tslc1 cDNA ORF Clone, Mouse

CADM1 Background Information

Members of the immunoglobulin superfamily often play key roles in intercellular adhesion. IGSF4 is a novel immunoglobulin (Ig)-like intercellular adhesion molecule. Three Ig-like domains are included in the extracellular domain of IGSF4 and mediate homophilic or heterophilic interactions independently of Ca2+. The cytoplasmic domain of IGSF4 contains the binding motifs that connect to actin fibers. Since IGSF4 has been characterized by several independent research groups, this molecule is called by three names, TSLC1, SgIGSF and SynCAM. IGSF4 was first characterized as a tumor suppressor of non-small cell lung cancer and termed TSLC1. It is a single-pass type I membrane protein which belongs to the nectin family, which may be involved in neuronal migration, axon growth, pathfinding, and fasciculation on the axons of differentiating neurons. In addition, CADM1 may play diverse roles in the spermatogenesis including in the adhesion of spermatocytes and spermatids to Sertoli cells and for their normal differentiation into mature spermatozoa. In neuroblastoma, loss of CADM1 expression has recently been found in disseminated tumours with adverse outcome, prompting us to investigate its role in neuroblastoma tumour progression. The downregulation of CADM1 tumour suppressor gene expression is a critical event in neuroblastoma pathogenesis resulting in tumour progression.
Full Name
cell adhesion molecule 1
References
  • Watabe K, et al. (2003) IGSF4: a new intercellular adhesion molecule that is called by three names, TSLC1, SgIGSF and SynCAM, by virtue of its diverse function. Histol Histopathol. 18(4): 1321-9.
  • Fujita E, et al. (2005) Distribution of RA175/TSLC1/SynCAM, a member of the immunoglobulin superfamily, in the developing nervous system. Brain Res Dev Brain Res. 154(2): 199-209.
  • Fujita E, et al. (2006) Oligo-astheno-teratozoospermia in mice lacking RA175/TSLC1/SynCAM/IGSF4A, a cell adhesion molecule in the immunoglobulin superfamily. Mol Cell Biol. 26(2): 718-26.
  • Nowacki S, et al. (2008) Expression of the tumour suppressor gene CADM1 is associated with favourable outcome and inhibits cell survival in neuroblastoma. Oncogene. 27(23): 3329-38.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait