After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь Carbonic Anhydrase IV / Car4 / CA4 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse CA4 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_007607.2
Размер кДНК:918bp
Описание кДНК:Full length Clone DNA of Mus musculus carbonic anhydrase 4 with C terminal Myc tag.
Синоним гена:Ca4, AW456718, Car4
Виды:Mouse
переносчик:pCMV3-C-Myc
Plasmid:
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Мышь Carbonic Anhydrase IV / Car4 / CA4 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка on other vectors
Мышь Carbonic Anhydrase IV / Car4 / CA4 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50350-ACGRBS15396
Мышь Carbonic Anhydrase IV / Car4 / CA4 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50350-ACRRBS15396
Мышь Carbonic Anhydrase IV / Car4 / CA4 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50350-CFRBS13343
Мышь Carbonic Anhydrase IV / Car4 / CA4 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50350-CHRBS13343
Мышь Carbonic Anhydrase IV / Car4 / CA4 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50350-CHRBS13343
Мышь Carbonic Anhydrase IV / Car4 / CA4 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50350-CMRBS13343
Мышь Carbonic Anhydrase IV / Car4 / CA4 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50350-CYRBS13343
Мышь Carbonic Anhydrase IV / Car4 / CA4 Джин клон кДНК в вектор клонированияMG50350-MRBS5132
Мышь Carbonic Anhydrase IV / Car4 / CA4 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50350-NFRBS13343
Мышь Carbonic Anhydrase IV / Car4 / CA4 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50350-NHRBS13343
Мышь Carbonic Anhydrase IV / Car4 / CA4 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50350-NMRBS13343
Мышь Carbonic Anhydrase IV / Car4 / CA4 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50350-NYRBS13343
Мышь Carbonic Anhydrase IV / Car4 / CA4 Джин ORF экспрессии кДНК клона плазмидыMG50350-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

The carbonic anhydrases (or carbonate dehydratases) are classified as metalloenzyme for its zinc ion prosthetic group and form a family of enzymes that catalyze the rapid interconversion of carbon dioxide and water to bicarbonate and protons, a reversible reaction that takes part in maintaining acid-base balance in blood and other tissues. The carbonic anhydrasekl (CA) family consists of at least 11 enzymatically active members and a few inactive homologous proteins. Carbonic anhydrase IV (CAIV) is a membrane-associated enzyme anchored to plasma membrane surfaces by a phosphatidylinositol glycan linkage. CAIV is a high-activity isozyme in CO2 hydration comparable to that of CAII. Furthermore, CAIV is more active in HCO3- dehydration than is CAII. However, the esterase activity of CAIV is decreased 150-fold compared to CAII.

Ссылки
  • Lehtonen J, et al. (2004) Characterization of CA XIII, a Novel Member of the Carbonic Anhydrase Isozyme Family. The Journal of Biological Chemistry. 279: 2719-27.
  • Lindskog S. (1997) Structure and mechanism of carbonic anhydrase. Pharmacology & Therapeutics. 74(1):1-20.
  • Baird TT, et al. (1997) Catalysis and Inhibition of Human Carbonic Anhydrase IV. Biochemistry. 36 (9): 2669-78.
  • Size / Price
    Каталог: MG50350-CM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».