After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь C1QBP/HABP1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse C1QBP Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_007573.2
Размер кДНК:840bp
Описание кДНК:Full length Clone DNA of Mus musculus complement component 1, q subcomponent binding protein with N terminal Myc tag.
Синоним гена:P32, HABP1, gC1qBP, AA407365, AA986492, D11Wsu182e, C1qbp
Виды:Mouse
переносчик:pCMV3-N-Myc
Plasmid:
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Мышь C1QBP/HABP1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Мышь C1QBP/HABP1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50199-ACGRBS15400
Мышь C1QBP/HABP1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50199-ACRRBS15400
Мышь C1QBP/HABP1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG50199-ANGRBS15400
Мышь C1QBP/HABP1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG50199-ANRRBS15400
Мышь C1QBP/HABP1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50199-CFRBS13340
Мышь C1QBP/HABP1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50199-CHRBS13340
Мышь C1QBP/HABP1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50199-CMRBS13340
Мышь C1QBP/HABP1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50199-CYRBS13340
Мышь C1QBP/HABP1 Джин клон кДНК в вектор клонированияMG50199-MRBS5130
Мышь C1QBP/HABP1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50199-NFRBS13340
Мышь C1QBP/HABP1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50199-NHRBS13340
Мышь C1QBP/HABP1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50199-NMRBS13340
Мышь C1QBP/HABP1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50199-NYRBS13340
Мышь C1QBP/HABP1 Джин ORF экспрессии кДНК клона плазмидыMG50199-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Hyaluronan binding protein 1 (HABP1), also known as p32 or gC1qR, is a ubiquitously expressed multifunctional phospho-protein implicated in cell signalling. Hyaluronan-binding protein 1 (HABP1) /p32/gC1qR was characterized as a highly acidic and oligomeric protein, which binds to different ligands like hyaluronan, C1q, and mannosylated albumin. The role of hyaluronan binding protein 1 (HABP1) in cell signaling was investigated and in vitro. HABP1 overexpressing cells showed extensive vacuolation and reduced growth rate, which was corrected by frequent medium replenishment. Further investigation revealed that HABP1 overexpressing cells undergo apoptosis, and they failed to enter into the S-phase. The sperm surface HABP1 level can be correlated with the degree of sperm motility.Hyaluronan binding protein 1 (HABP1) was reported to be present on human sperm surface and its involvement in fertilization has already been elucidated: decreased HABP1 level may be associated with low motility of sperms, which in turn might cause infertility in the patient. HABP1 also is an endogenous substrate for MAP kinase and upon mitogenic stimulation it is translocated to the nucleus in a MAP kinase-dependent manner.

Ссылки
  • Meenakshi J, et al. (2003) Constitutive expression of hyaluronan binding protein 1 (HABP1/p32/gC1qR) in normal fibroblast cells perturbs its growth characteristics and induces apoptosis. Biochemicaland Biophysical Research Communication. 300(3): 686-93.
  • Majumdar M, et al. (2002) Hyaluronan Binding Protein 1 (HABP1) /C1QBP/p32 Is an Endogenous Substrate for MAP Kinase and Is Translocated to the Nucleus upon Mitogenic Stimulation. Biochemical and Biophysical Research Communications. 291(4): 829-37.
  • Ghosh I, et al. (2002) Reduction in the level of hyaluronan binding protein 1 (HABP1) is associated with loss of sperm motility. Journal of Reproductive Immunology. 53(1-2): 45-54.
  • Size / Price
    Каталог: MG50199-NM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».