After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь BMP-2 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse BMP2 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_007553.2
Размер кДНК:1185bp
Описание кДНК:Full length Clone DNA of Mus musculus bone morphogenetic protein 2 with C terminal HA tag.
Синоним гена:Bmp2a, AI467020, Bmp2
Виды:Mouse
переносчик:pCMV3-C-HA
Plasmid:
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Мышь BMP-2 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Мышь BMP-2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51115-ACGRBS15400
Мышь BMP-2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51115-ACRRBS15400
Мышь BMP-2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51115-CFRBS13340
Мышь BMP-2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51115-CHRBS13340
Мышь BMP-2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51115-CMRBS13340
Мышь BMP-2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51115-CYRBS13340
Мышь BMP-2 Джин клон кДНК в вектор клонированияMG51115-GRBS5130
Мышь BMP-2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51115-G-FRBS13340
Мышь BMP-2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51115-NFRBS13340
Мышь BMP-2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51115-NHRBS13340
Мышь BMP-2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51115-NMRBS13340
Мышь BMP-2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51115-NYRBS13340
Мышь BMP-2 Джин ORF экспрессии кДНК клона плазмидыMG51115-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

BMP-2 protein, like other bone morphogenetic proteins, plays an important role in the development of bone and cartilage. BMP-2 protein is involved in the hedgehog pathway, TGF beta signaling pathway, and cytokine-cytokine receptor interaction. BMP-2 and BMP-7 are osteogenic BMPs that have been demonstrated to potently induce osteoblast differentiation in a variety of cell types. BMP-2, BMP-4 and BMP-7 are known to be of major importance in bone formation and repair. In cancerous tissues BMP-2 protein may play an important role in the progression of glioma.

Ссылки
  • Jiao X, et al. (2007) Heparan sulfate proteoglycans (HSPGs) modulate BMP-2 osteogenic bioactivity in C2C12 cells. J Biol Chem. 282(2):1080-6.
  • Michon F, et al. (2008) BMP-2 and BMP-7 play antagonistic roles in feather induction. Development 135 (16):2797-805.
  • Size / Price
    Каталог: MG51115-CY
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».