BMP4 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag

Price:
Size:
Number:

BMP4 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1227 bp
Description
Full length Clone DNA of Mouse bone morphogenetic protein 4 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

BMP4 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag: Alternative Names

Bmp-4 cDNA ORF Clone, Mouse; Bmp2b cDNA ORF Clone, Mouse; Bmp2b-1 cDNA ORF Clone, Mouse; Bmp2b1 cDNA ORF Clone, Mouse

BMP4 Background Information

BMP4 (bone morphogenetic protein-4)-directed differentiation of human embryonic stem cells (ESCd). Autophagy is a conserved catabolic process with complicated roles in tumor development. Bone morphogenetic protein 4 (BMP4), a member of the transforming growth factor (TGF-β) family of regulatory proteins, plays a crucial role in human malignancies. BMP4 treatment promoted HCC cells proliferation and induced autophagy. Mechanistic study revealed that the induction of autophagy by BMP4 was mediated through activating the JNK1/Bcl2 pathway. And the JNK1 inhibitor and knockdown of JNK1 could attenuate autophagy induced by BMP4 and eliminated BMP4-promoted HCC cells growth. BMP4 promoted HCC proliferation by autophagy activation through JNK1/Bcl-2 signaling.
Full Name
bone morphogenetic protein 4
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait